HUGE

Gene/Protein Characteristic Table for KIAA1106

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01147
Accession No. :	AB029029
Description :	Myelin transcription factor 1-like protein.
HUGO Gene Name :	myelin transcription factor 1-like (MYT1L)
Clone Name :	fg01888 [Vector Info]
Flexi ORF Clone :	pF1KA1106
Source :	Human fetal brain
Note :	We replaced hh02905, former representative clones for KIAA1106 with fg01888. (2001/5/29)

Features of the cloned DNA sequence	Description

Length: 6953 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2746 bp

Genome contig ID gi89161199r_1671900
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ATAAACAAGGTGTTGCCACATTTGTAGCACGAAGG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATCTCTAACCCGGGTCTGCGTCTTCACTTGAGTCTGGGAAATGCTGTCTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 r 1771900 2314033 26 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 1154 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI50282	100.0	MYT1L protein [...	Homo sapiens
AAI37274	95.6	Myelin transcri...	Homo sapiens
XP_001096422	95.1	myelin transcri...	Macaca mulatta
Q9UL68	95.2	Myelin transcri...	Homo sapiens
AAF14051	95.1	myelin transcri...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020642	1.2e-95	48.4	KIAA0835
AB028973	5e-86	57.0	KIAA1050
AB011107	1.9e-72	43.0	KIAA0535

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002515 50 80 PF01530 Zinc finger

IPR002515 471 501 PF01530 Zinc finger

IPR002515 515 545 PF01530 Zinc finger

IPR013681 589 841 PF08474 Myelin transcription factor 1

IPR002515 870 900 PF01530 Zinc finger

IPR002515 919 949 PF01530 Zinc finger

IPR002515 972 1002 PF01530 Zinc finger

ScanRegExp IPR002048 800 812 PS00018 Calcium-binding EF-hand

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002515	50	80	PF01530	Zinc finger
IPR002515	471	501	PF01530	Zinc finger
IPR002515	515	545	PF01530	Zinc finger
IPR013681	589	841	PF08474	Myelin transcription factor 1
IPR002515	870	900	PF01530	Zinc finger
IPR002515	919	949	PF01530	Zinc finger
IPR002515	972	1002	PF01530	Zinc finger
ScanRegExp	IPR002048	800	812	PS00018	Calcium-binding EF-hand

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ATGCATTTCCCCACCGCGTTG

Primer_r
: CAACGTTAGATGAGCAGCAGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: CCR
Primer_f	: ATGCATTTCCCCACCGCGTTG
Primer_r	: CAACGTTAGATGAGCAGCAGG
PCR product length	: 157 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2746 bp
Genome contig ID	gi89161199r_1671900
PolyA signal sequence (None)	+--------+--------+----*----+---- ATAAACAAGGTGTTGCCACATTTGTAGCACGAAGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATCTCTAACCCGGGTCTGCGTCTTCACTTGAGTCTGGGAAATGCTGTCTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	r	1771900	2314033	26	99.8	Perfect prediction

Gene/Protein Characteristic Table for KIAA1106

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information