Gene/Protein Characteristic Table for KIAA1050

Length: 5969 bp

Restriction map

Length of 3'UTR	3479 bp
Genome contig ID	gi51511747f_62209913
PolyA signal sequence (AATAAA,-17)	+----*----+----*----+----*----+---- TGGTGTTTACCTTATGAAAATAAAGGATTGTAAGT
Flanking genome sequence (167536 - 167585)	----+----*----+----*----+----*----+----*----+----* AAAGTTTCCTGCGCACCTTATACCAGAATTCAGTATAATACACTACTTTC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	20	f	62309870	62377447	22	99.5	Perfect prediction

Length: 829 aa

Entry Exp ID% Protein Source Q01538 0 100.0 Myelin transcri... Homo sapiens EDL07461 0 95.1 myelin transcri... Mus musculus EDL07462 0 95.1 myelin transcri... Mus musculus Q8CFC2 0 95.1 Myelin transcri... Mus musculus CAM20796 0 95.1 myelin transcri... Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% HUGE_ID AB020642 3.6e-193 100.0 KIAA0835 AB029029 5.9e-89 57.2 KIAA1106 AB011107 9.1e-83 55.9 KIAA0535

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002515	147	177	PF01530	Zinc finger
	IPR002515	191	221	PF01530	Zinc finger
	IPR013681	268	482	PF08474	Myelin transcription factor 1
	IPR002515	505	535	PF01530	Zinc finger
	IPR002515	549	579	PF01530	Zinc finger
	IPR002515	598	628	PF01530	Zinc finger
	IPR002515	651	681	PF01530	Zinc finger

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-