HUGE |
Gene/Protein Characteristic Table for KIAA0861 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK05947 |
---|---|
Accession No. : | AB020668 |
Description : | Rho family guanine-nucleotide exchange factor. |
HUGO Gene Name : | MCF.2 cell line derived transforming sequence-like 2 (MCF2L2) |
Clone Name : | hk06521 [Vector Info] |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4282 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1333 bp Genome contig ID gi89161205r_184278525 PolyA signal sequence
(ATTAAA,-25) +----*----+----*----+----*----+----
TTATTTGACTATTAAACACTCACTGGAAGTTCATGFlanking genome sequence
(360847 - 360798) ----+----*----+----*----+----*----+----*----+----*
AATGGAGGTTCATGTTGCTCAGCCCATGCATACTCTCTATCTCTTTCACC
Chr f/r start end exon identity class ContigView(URL based/DAS) 3 r 184377653 184539371 28 98.4 Terminal No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 982 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: GACTTGAGAAATACATCCTGC | |
: CAGTCTTCAAAGGTGTCCATG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 3 |
: GeneBridge 4 | |
: ACATGGAAAAGGAGAGCAGTG | |
: CGTTTCCTCCTCATCGCGTTC | |
: 146 (0.5k) bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |