HUGE

Gene/Protein Characteristic Table for KIAA0861

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05947
Accession No. :	AB020668
Description :	Rho family guanine-nucleotide exchange factor.
HUGO Gene Name :	MCF.2 cell line derived transforming sequence-like 2 (MCF2L2)
Clone Name :	hk06521 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4282 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1333 bp

Genome contig ID gi89161205r_184278525
PolyA signal sequence
(ATTAAA,-25)
+----*----+----*----+----*----+----
TTATTTGACTATTAAACACTCACTGGAAGTTCATG
Flanking genome sequence
(360847 - 360798)
----+----*----+----*----+----*----+----*----+----*
AATGGAGGTTCATGTTGCTCAGCCCATGCATACTCTCTATCTCTTTCACC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 r 184377653 184539371 28 98.4 Terminal No-hit

Features of the protein sequence	Description

Length: 982 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAO19651	99.9	Rho family guan...	Homo sapiens
Q86YR7	99.8	Probable guanin...	Homo sapiens
NP_055893	99.7	Rho family guan...	Homo sapiens
XP_535818	81.6	similar to Rho ...	Canis lupus fam...
XP_001790475	79.7	similar to Rho ...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002360	2.3e-60	43.0	KIAA0362
AB067496	4e-10	24.2	KIAA1909
AB029035	4.4e-05	27.6	KIAA1112
AB046859	0.00028	23.7	KIAA1639

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000219 491 689 PF00621 DH

IPR001849 709 822 PF00169 Pleckstrin-like

HMMSmart IPR002017 191 296 SM00150 Spectrin repeat

IPR000219 491 689 SM00325 DH

IPR001849 709 824 SM00233 Pleckstrin-like

ProfileScan IPR001251 1 61 PS50191 Cellular retinaldehyde-binding/triple function

IPR000219 487 690 PS50010 DH

IPR001849 702 822 PS50003 Pleckstrin-like

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000219	491	689	PF00621	DH
IPR001849	709	822	PF00169	Pleckstrin-like
HMMSmart	IPR002017	191	296	SM00150	Spectrin repeat
IPR000219	491	689	SM00325	DH
IPR001849	709	824	SM00233	Pleckstrin-like
ProfileScan	IPR001251	1	61	PS50191	Cellular retinaldehyde-binding/triple function
IPR000219	487	690	PS50010	DH
IPR001849	702	822	PS50003	Pleckstrin-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GACTTGAGAAATACATCCTGC

Primer_r
: CAGTCTTCAAAGGTGTCCATG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ACATGGAAAAGGAGAGCAGTG
Primer_r	: CGTTTCCTCCTCATCGCGTTC
PCR product length	: 146 (0.5k) bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1333 bp
Genome contig ID	gi89161205r_184278525
PolyA signal sequence (ATTAAA,-25)	+--------+--------+----*----+---- TTATTTGACTATTAAACACTCACTGGAAGTTCATG
Flanking genome sequence (360847 - 360798)	----+--------+--------+--------+--------+----* AATGGAGGTTCATGTTGCTCAGCCCATGCATACTCTCTATCTCTTTCACC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	r	184377653	184539371	28	98.4	Terminal No-hit

Primer_f	: GACTTGAGAAATACATCCTGC
Primer_r	: CAGTCTTCAAAGGTGTCCATG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0861

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information