| HUGE |
Gene/Protein Characteristic Table for KIAA1909 |
|
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK07571 |
|---|---|
| Accession No. : | AB067496 |
| Description : | |
| HUGO Gene Name : | pleckstrin homology domain containing, family G (with RhoGef domain) member 4B (PLEKHG4B) |
| Clone Name : | ff10210 [Vector Info] |
| Source : | Human fetal brain |
| Note : | We replaced fh11423, former representative clones for KIAA1909 with ff10210. (2005/08/06) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 11527 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 7661 bp Genome contig ID gi51511721f_93373 PolyA signal sequence
(None) +----*----+----*----+----*----+----
AAAAAAAAAAAAGGGCGACCGCTCGCGATCTAGAAFlanking genome sequence None
Chr f/r start end exon identity class ContigView(URL based/DAS) 5 f 193373 280063 22 99.2 Both No-hit
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1287 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|

Experimental conditions
| : GTGAATTTGAAGGAACAGGGG | |
| : TTCTCTGTCATCCCGATCTCG | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 5 |
| : genbank | |
| : - | |
| : - | |
| : - | |
| : - |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |