HUGE

Gene/Protein Characteristic Table for KIAA0875

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00668
Accession No. :	AB020682
Description :	F-box only protein 21.
HUGO Gene Name :	F-box protein 21 (FBXO21)
Clone Name :	hk07350 [Vector Info]
Flexi ORF Clone :	pF1KSDA0875
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4168 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2301 bp

Genome contig ID gi89161190r_115965974
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
TTGTACAATGATTAATAAATGGAACTTATCCAGAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAACCACGCAAATGGCCTGCCCAATTTCGTTTGAGGACAGAAAGCCCAGC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 r 116065974 116112645 12 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 621 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH91496	100.0	FBXO21 protein ...	Homo sapiens
XP_001083109	99.7	similar to F-bo...	Macaca mulatta
Q5R5S1	99.7	F-box only prot...	Pongo abelii
O94952	98.9	F-box only prot...	Homo sapiens
XP_001082993	98.6	similar to F-bo...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom NULL 496 573 PD415267 NULL

HMMPfam IPR001810 28 77 PF00646 Cyclin-like F-box

IPR011722 493 593 PF08755 Hemimethylated DNA-binding region

HMMTigr IPR011722 493 590 TIGR02097 Hemimethylated DNA-binding region

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	NULL	496	573	PD415267	NULL
HMMPfam	IPR001810	28	77	PF00646	Cyclin-like F-box
IPR011722	493	593	PF08755	Hemimethylated DNA-binding region
HMMTigr	IPR011722	493	590	TIGR02097	Hemimethylated DNA-binding region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ATGTTGAATGCCTGCTGCTTG

Primer_r
: GCTGTGAGTGGTTACGTTTCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GAGCTATTTAATCCACTGTCC
Primer_r	: GCTGTGAGTGGTTACGTTTCC
PCR product length	: 91 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2301 bp
Genome contig ID	gi89161190r_115965974
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TTGTACAATGATTAATAAATGGAACTTATCCAGAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAACCACGCAAATGGCCTGCCCAATTTCGTTTGAGGACAGAAAGCCCAGC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	r	116065974	116112645	12	99.4	Perfect prediction

Primer_f	: ATGTTGAATGCCTGCTGCTTG
Primer_r	: GCTGTGAGTGGTTACGTTTCC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0875

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information