HUGE

Gene/Protein Characteristic Table for KIAA0898

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07202
Accession No. :	AB020705
Description :	Tripartite motif-containing protein 37.
HUGO Gene Name :	tripartite motif-containing 37 (TRIM37)
Clone Name :	hk09541 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4111 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1171 bp

Genome contig ID gi51511734r_54330349
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
TAGTTTGCACTTTTTGTTAATAAAATCAACTTGAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAATATGCCTCTGCTGTTTATTAAATTGGGACCAGAAACCCCTTCTTTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 r 54430349 54538649 24 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 979 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_511914	99.6	tripartite moti...	Pan troglodytes
O94972	100.0	Tripartite moti...	Homo sapiens
BAF85148	99.9	unnamed protein...	Homo sapiens
AAH36012	99.9	Tripartite moti...	Homo sapiens
AAL36460	99.9	POB1 [Homo sapi...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029021	4.7e-05	23.4	KIAA1098
AB011089	0.00087	23.3	KIAA0517

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000315 118 135 PR01406 Zinc finger

IPR000315 138 152 PR01406 Zinc finger

HMMPfam IPR000315 105 147 PF00643 Zinc finger

IPR002083 298 406 PF00917 MATH

HMMSmart IPR000315 105 147 SM00336 Zinc finger

IPR003649 147 269 SM00502 B-box

IPR002083 296 399 SM00061 MATH

ProfileScan IPR001841 30 70 PS50089 Zinc finger

IPR000315 105 147 PS50119 Zinc finger

IPR002083 291 418 PS50144 MATH

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000315	118	135	PR01406	Zinc finger
IPR000315	138	152	PR01406	Zinc finger
HMMPfam	IPR000315	105	147	PF00643	Zinc finger
IPR002083	298	406	PF00917	MATH
HMMSmart	IPR000315	105	147	SM00336	Zinc finger
IPR003649	147	269	SM00502	B-box
IPR002083	296	399	SM00061	MATH
ProfileScan	IPR001841	30	70	PS50089	Zinc finger
IPR000315	105	147	PS50119	Zinc finger
IPR002083	291	418	PS50144	MATH

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AACTTTGCCATTGTGCTCCTG

Primer_r
: GCATTCAGCAAGACATCAGAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1171 bp
Genome contig ID	gi51511734r_54330349
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- TAGTTTGCACTTTTTGTTAATAAAATCAACTTGAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAATATGCCTCTGCTGTTTATTAAATTGGGACCAGAAACCCCTTCTTTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	r	54430349	54538649	24	100.0	Perfect prediction

Primer_f	: AACTTTGCCATTGTGCTCCTG
Primer_r	: GCATTCAGCAAGACATCAGAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0898

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information