| HUGE |
Gene/Protein Characteristic Table for KIAA0517 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00550 |
|---|---|
| Accession No. : | AB011089 |
| Description : | Tripartite motif-containing protein 2. |
| HUGO Gene Name : | tripartite motif-containing 2 (TRIM2) |
| Clone Name : | hg00752 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA0517
|
| Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 6740 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 4359 bp Genome contig ID gi89161207f_154245068 PolyA signal sequence
(AATAAA,-25)
AAATCATTATAATAAAGCTTGTTTTCTCCATTTGCFlanking genome sequence
(234858 - 234907)
AGAGTGAATATTTATTTATTTAATATTTCTCCATTTGCAGAGTGAATATT
Chr f/r start end exon identity class ContigView(URL based/DAS) 4 f 154345068 154479924 12 99.3 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 792 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR | Description |
|---|
| : TCATTGTAGACTAAAGCATCC | |
| : TGCACTCTCTGACATTGATAC | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 4 |
| : GeneBridge 4 | |
| : TCATTGTAGACTAAAGCATCC | |
| : TGCACTCTCTGACATTGATAC | |
| : 166 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
