| HUGE |
Gene/Protein Characteristic Table for KIAA0902 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK04592 |
|---|---|
| Accession No. : | AB020709 |
| Description : | Connector enhancer of kinase suppressor of ras 2. |
| HUGO Gene Name : | connector enhancer of kinase suppressor of Ras 2 (CNKSR2) |
| Clone Name : | hk09777 [Vector Info] |
| Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4349 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 1211 bp Genome contig ID gi89161218f_21202481 PolyA signal sequence
(AATAAA,-27)
TACTTAAAAATAAAAATATGACCAATTGGTATCAGFlanking genome sequence
(368294 - 368343)
ATCTTTTCAGATAGCTAAATAATTTGCTAAGTATGCCTGATAGTAAATAT
Features of the protein sequence |
Description | |
|---|---|---|
Length: 910 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|
Experimental conditions
| : AATCTATAGGCTGTGGGTTTC | |
| : ATTGATTGAGCCATAGGGGAC | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 1 |
| : GeneBridge 4 | |
| : AATCTATAGGCTGTGGGTTTC | |
| : ATTGATTGAGCCATAGGGGAC | |
| : 113 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
