HUGE

Gene/Protein Characteristic Table for KIAA0403

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05597
Accession No. :	AB007863
Description :	phosphoinositide-binding protein PIP3-E.
HUGO Gene Name :
Clone Name :	hg01159 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6467 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 5216 bp

Genome contig ID gi89161210r_154417438
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
TTCTCAAAGAAATAAACATGTGGCTGGAAGTGTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATGGCTGCGTTTTGATCGTCTACAACAAGGTTACAGTGCCCTCTGGTGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 r 154517438 154609588 8 99.2 Terminal No-hit

Features of the protein sequence	Description

Length: 416 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8WWN9	3e-143	100.0	Interactor prot...	Homo sapiens
BAF82606	3e-143	100.0	unnamed protein...	Homo sapiens
CAI46054	5.8e-143	99.8	hypothetical pr...	Homo sapiens
XP_527543	2.6e-141	99.0	hypothetical pr...	Pan troglodytes
EAW47702	7.9e-141	100.0	phosphoinositid...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020709	2.7e-17	38.1	KIAA0902
AB051473	0.0008	26.0	KIAA1686

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001849 21 119 PF00169 Pleckstrin-like

HMMSmart IPR001849 21 121 SM00233 Pleckstrin-like

ProfileScan IPR001849 20 119 PS50003 Pleckstrin-like

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001849	21	119	PF00169	Pleckstrin-like
HMMSmart	IPR001849	21	121	SM00233	Pleckstrin-like
ProfileScan	IPR001849	20	119	PS50003	Pleckstrin-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: TGCAGGACAAAAATGAACACC

Primer_r
: TTACTGTGCTCTCATCCTGTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TGCAGGACAAAAATGAACACC
Primer_r	: TTACTGTGCTCTCATCCTGTG
PCR product length	: 188 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	5216 bp
Genome contig ID	gi89161210r_154417438
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- TTCTCAAAGAAATAAACATGTGGCTGGAAGTGTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATGGCTGCGTTTTGATCGTCTACAACAAGGTTACAGTGCCCTCTGGTGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	r	154517438	154609588	8	99.2	Terminal No-hit

Gene/Protein Characteristic Table for KIAA0403

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information