HUGE

Gene/Protein Characteristic Table for KIAA1686

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00886
Accession No. :	AB051473
Description :	Pleckstrin homology domain-containing family A member 5.
HUGO Gene Name :	pleckstrin homology domain containing, family A member 5 (PLEKHA5)
Clone Name :	fh25862s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA1686
Source :	Human fetal brain
Note :	We replaced fh25862, former representative clones for KIAA1686 with fh25862s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 6488 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2959 bp

Genome contig ID gi89161190f_19073997
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CTCCAGCCTGGGCAACAAGAACGAAACTCTGTCTC
Flanking genome sequence
(343874 - 343923)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAATGGTGACTGTTGCTACTGGTGACGTAATAACACAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 f 19173997 19417869 28 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 1175 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW96392	100.0	pleckstrin homo...	Homo sapiens
EAW96394	90.2	pleckstrin homo...	Homo sapiens
XP_001093182	92.4	similar to plec...	Macaca mulatta
XP_520779	94.2	pleckstrin homo...	Pan troglodytes
BAG58986	88.3	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023186	1.8e-20	31.1	KIAA0969
AB020709	8.1e-05	23.9	KIAA0902
AB007863	0.00043	25.1	KIAA0403

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001202 13 42 PF00397 WW/Rsp5/WWP

IPR001202 59 88 PF00397 WW/Rsp5/WWP

IPR001849 171 269 PF00169 Pleckstrin-like

HMMSmart IPR001202 12 44 SM00456 WW/Rsp5/WWP

IPR001202 58 90 SM00456 WW/Rsp5/WWP

IPR001849 171 271 SM00233 Pleckstrin-like

ProfileScan IPR001202 11 44 PS50020 WW/Rsp5/WWP

IPR001202 57 90 PS50020 WW/Rsp5/WWP

IPR001849 170 269 PS50003 Pleckstrin-like

ScanRegExp IPR001202 17 42 PS01159 WW/Rsp5/WWP

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001202	13	42	PF00397	WW/Rsp5/WWP
IPR001202	59	88	PF00397	WW/Rsp5/WWP
IPR001849	171	269	PF00169	Pleckstrin-like
HMMSmart	IPR001202	12	44	SM00456	WW/Rsp5/WWP
IPR001202	58	90	SM00456	WW/Rsp5/WWP
IPR001849	171	271	SM00233	Pleckstrin-like
ProfileScan	IPR001202	11	44	PS50020	WW/Rsp5/WWP
IPR001202	57	90	PS50020	WW/Rsp5/WWP
IPR001849	170	269	PS50003	Pleckstrin-like
ScanRegExp	IPR001202	17	42	PS01159	WW/Rsp5/WWP

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ACAAGATGAAGGTAGAGGCAC

Primer_r
: CATTTCTATCTCTTGGCTGGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2959 bp
Genome contig ID	gi89161190f_19073997
PolyA signal sequence (None)	+--------+--------+----*----+---- CTCCAGCCTGGGCAACAAGAACGAAACTCTGTCTC
Flanking genome sequence (343874 - 343923)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAATGGTGACTGTTGCTACTGGTGACGTAATAACACAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	f	19173997	19417869	28	99.5	Perfect prediction

Primer_f	: ACAAGATGAAGGTAGAGGCAC
Primer_r	: CATTTCTATCTCTTGGCTGGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1686

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information