HUGE

Gene/Protein Characteristic Table for KIAA0969

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00703
Accession No. :	AB023186
Description :	Pleckstrin homology domain-containing family A member 6.
HUGO Gene Name :	pleckstrin homology domain containing, family A member 6 (PLEKHA6)
Clone Name :	hj06525 [Vector Info]
Flexi ORF Clone :	pF1KSDA0969
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5047 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1583 bp

Genome contig ID gi89161185r_202356972
PolyA signal sequence
(AGTAAA,-24)
+----*----+----*----+----*----+----
GTTCATATGCAAGTAAAGATGACAATTTACTCAAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAATATTTATCGAGCACCTTTTATGTACCAGGCACTGTTGTAGGTGCTTA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 r 202456972 202595667 24 99.6 Internal No-hit

Features of the protein sequence	Description

Length: 1091 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW91509	99.9	pleckstrin homo...	Homo sapiens
AAI52476	100.0	Pleckstrin homo...	Homo sapiens
EAW91510	99.9	pleckstrin homo...	Homo sapiens
Q9Y2H5	99.8	Pleckstrin homo...	Homo sapiens
XP_001488918	92.2	similar to Plec...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051473	2.2e-14	31.3	KIAA1686

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001849 103 201 PF00169 Pleckstrin-like

HMMSmart IPR001849 103 203 SM00233 Pleckstrin-like

ProfileScan IPR001849 102 201 PS50003 Pleckstrin-like

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001849	103	201	PF00169	Pleckstrin-like
HMMSmart	IPR001849	103	203	SM00233	Pleckstrin-like
ProfileScan	IPR001849	102	201	PS50003	Pleckstrin-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGGCTAGGCGCTCTCATGATC

Primer_r
: GGCTACATTCGTCTCCAGGTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1583 bp
Genome contig ID	gi89161185r_202356972
PolyA signal sequence (AGTAAA,-24)	+--------+--------+----*----+---- GTTCATATGCAAGTAAAGATGACAATTTACTCAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATATTTATCGAGCACCTTTTATGTACCAGGCACTGTTGTAGGTGCTTA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	r	202456972	202595667	24	99.6	Internal No-hit

Primer_f	: AGGCTAGGCGCTCTCATGATC
Primer_r	: GGCTACATTCGTCTCCAGGTG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0969

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information