HUGE

Gene/Protein Characteristic Table for KIAA0903

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04858
Accession No. :	AB020710
Description :	EH domain-binding protein 1.
HUGO Gene Name :	EH domain binding protein 1 (EHBP1)
Clone Name :	hk09970 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 3875 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 984 bp

Genome contig ID gi89161199f_62839874
PolyA signal sequence
(AATAAA,-26)
+----*----+----*----+----*----+----
TAAATTTTCAATAAAAGCAGAAACTTTCTTACCTT
Flanking genome sequence
(287251 - 287300)
----+----*----+----*----+----*----+----*----+----*
AAACACGGCTGCTACTTTCTTGCAATGAAAACTTGACATTGGCTTGAATG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 f 62939874 63127123 17 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 962 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAS48537	100.0	EH domain bindi...	Homo sapiens
Q8NDI1	100.0	EH domain-bindi...	Homo sapiens
EAW99970	100.0	EH domain bindi...	Homo sapiens
CAD38814	99.9	hypothetical pr...	Homo sapiens
XP_001162250	99.7	EH domain bindi...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020626	1.9e-07	22.6	KIAA0819
AB037785	8.4e-07	40.9	KIAA1364
AB018293	9.9e-07	29.0	KIAA0750
AB051455	2e-06	23.6	KIAA1668
AB008567	2.8e-05	23.0	KIAA0302

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001715 175 279 PF00307 Calponin-like actin-binding

HMMSmart IPR001715 176 274 SM00033 Calponin-like actin-binding

ProfileScan IPR001715 174 276 PS50021 Calponin-like actin-binding

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001715	175	279	PF00307	Calponin-like actin-binding
HMMSmart	IPR001715	176	274	SM00033	Calponin-like actin-binding
ProfileScan	IPR001715	174	276	PS50021	Calponin-like actin-binding

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CACCAGTTTACAAAGACAGTC

Primer_r
: TTCGTGAGCCAATGTTGAGAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CACCAGTTTACAAAGACAGTC
Primer_r	: TTCGTGAGCCAATGTTGAGAC
PCR product length	: 119 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	984 bp
Genome contig ID	gi89161199f_62839874
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- TAAATTTTCAATAAAAGCAGAAACTTTCTTACCTT
Flanking genome sequence (287251 - 287300)	----+--------+--------+--------+--------+----* AAACACGGCTGCTACTTTCTTGCAATGAAAACTTGACATTGGCTTGAATG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	f	62939874	63127123	17	99.7	Perfect prediction

Gene/Protein Characteristic Table for KIAA0903

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information