| HUGE |
Gene/Protein Characteristic Table for KIAA0302 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00045 |
|---|---|
| Accession No. : | AB008567 |
| Description : | Spectrin beta chain, brain 2. |
| HUGO Gene Name : | |
| Clone Name : | hf00409s2 [Vector Info] |
| Flexi ORF Clone : | pF1KA0302
|
| Source : | Human adult brain |
| Note : | We replaced hf00409 and hf00409s1, former representative clones for KIAA0302 with hf00409s2. (2006/4/25,2008/8/27) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 7864 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 619 bp Genome contig ID gi51511727r_66109299 PolyA signal sequence
(ATTAAA,-20)
CTGGCCAAGGAGGTGATTAAACAGCTCAGCTTCTCFlanking genome sequence
(100000 - 99951)
TCACCGCCTCTGGGTGTCTTTGCTTTCCTGACCACAGCCTCTCTGCCCAA
Chr f/r start end exon identity class ContigView(URL based/DAS) 11 r 66209299 66245446 37 99.9 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 2414 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR | Description |
|---|
| : AGAGCAGCTGGAGATGGAGTG | |
| : CCTTCTGCCTTCTGGTTCCTC | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 11 |
| : GeneBridge 4 | |
| : AGAGCAGCTGGAGATGGAGTG | |
| : CCTTCTGCCTTCTGGTTCCTC | |
| : 163 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) How to obtain anti KIAA antibodies Back to the HUGE Protein Database homepage 
| |
