HUGE

Gene/Protein Characteristic Table for KIAA1642

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB046862
Description :	Spectrin beta chain, brain 3.
HUGO Gene Name :	spectrin, beta, non-erythrocytic 4 (SPTBN4)
Clone Name :	hh02864 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5990 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
YES YES

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 0 bp

Genome contig ID gi42406306f_45600207
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GCCCCGGGCGCGGGACCGGCCCAAGCCGCGACGGC
Flanking genome sequence
(168097 - 168146)
----+----*----+----*----+----*----+----*----+----*
GGCCGCGGCCCAGAGAGGGTGGTGAGGGCGGGGGAAGCCGGCGCTCGCGC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 f 45700207 45768302 24 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1997 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9H254	100.0	Spectrin beta c...	Homo sapiens
AAG42473	100.0	spectrin beta I...	Homo sapiens
AAQ14860	99.8	non-erythrocyti...	Homo sapiens
AAG38874	99.6	beta4sigma1 spe...	Homo sapiens
XP_541613	96.5	similar to Spec...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB008567	5.4e-108	42.7	KIAA0302
AB002334	0.00094	20.9	KIAA0336

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002017 44 148 PF00435 Spectrin repeat

IPR002017 150 257 PF00435 Spectrin repeat

IPR002017 259 386 PF00435 Spectrin repeat

IPR002017 388 494 PF00435 Spectrin repeat

IPR002017 496 600 PF00435 Spectrin repeat

IPR002017 703 812 PF00435 Spectrin repeat

IPR002017 814 918 PF00435 Spectrin repeat

IPR002017 920 1023 PF00435 Spectrin repeat

IPR002017 1025 1128 PF00435 Spectrin repeat

IPR002017 1130 1234 PF00435 Spectrin repeat

IPR002017 1236 1340 PF00435 Spectrin repeat

IPR002017 1342 1447 PF00435 Spectrin repeat

IPR002017 1449 1555 PF00435 Spectrin repeat

IPR002017 1557 1661 PF00435 Spectrin repeat

IPR002017 1663 1722 PF00435 Spectrin repeat

HMMSmart IPR002017 47 147 SM00150 Spectrin repeat

IPR002017 153 256 SM00150 Spectrin repeat

IPR002017 262 385 SM00150 Spectrin repeat

IPR002017 391 493 SM00150 Spectrin repeat

IPR002017 499 599 SM00150 Spectrin repeat

IPR002017 605 700 SM00150 Spectrin repeat

IPR002017 706 811 SM00150 Spectrin repeat

IPR002017 817 917 SM00150 Spectrin repeat

IPR002017 923 1022 SM00150 Spectrin repeat

IPR002017 1028 1127 SM00150 Spectrin repeat

IPR002017 1133 1233 SM00150 Spectrin repeat

IPR002017 1239 1339 SM00150 Spectrin repeat

IPR002017 1345 1446 SM00150 Spectrin repeat

IPR002017 1452 1554 SM00150 Spectrin repeat

IPR002017 1560 1660 SM00150 Spectrin repeat

IPR002017 1666 1916 SM00150 Spectrin repeat

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002017	44	148	PF00435	Spectrin repeat
IPR002017	150	257	PF00435	Spectrin repeat
IPR002017	259	386	PF00435	Spectrin repeat
IPR002017	388	494	PF00435	Spectrin repeat
IPR002017	496	600	PF00435	Spectrin repeat
IPR002017	703	812	PF00435	Spectrin repeat
IPR002017	814	918	PF00435	Spectrin repeat
IPR002017	920	1023	PF00435	Spectrin repeat
IPR002017	1025	1128	PF00435	Spectrin repeat
IPR002017	1130	1234	PF00435	Spectrin repeat
IPR002017	1236	1340	PF00435	Spectrin repeat
IPR002017	1342	1447	PF00435	Spectrin repeat
IPR002017	1449	1555	PF00435	Spectrin repeat
IPR002017	1557	1661	PF00435	Spectrin repeat
IPR002017	1663	1722	PF00435	Spectrin repeat
HMMSmart	IPR002017	47	147	SM00150	Spectrin repeat
IPR002017	153	256	SM00150	Spectrin repeat
IPR002017	262	385	SM00150	Spectrin repeat
IPR002017	391	493	SM00150	Spectrin repeat
IPR002017	499	599	SM00150	Spectrin repeat
IPR002017	605	700	SM00150	Spectrin repeat
IPR002017	706	811	SM00150	Spectrin repeat
IPR002017	817	917	SM00150	Spectrin repeat
IPR002017	923	1022	SM00150	Spectrin repeat
IPR002017	1028	1127	SM00150	Spectrin repeat
IPR002017	1133	1233	SM00150	Spectrin repeat
IPR002017	1239	1339	SM00150	Spectrin repeat
IPR002017	1345	1446	SM00150	Spectrin repeat
IPR002017	1452	1554	SM00150	Spectrin repeat
IPR002017	1560	1660	SM00150	Spectrin repeat
IPR002017	1666	1916	SM00150	Spectrin repeat

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCGCTGTCTACCGCATGTTTG

Primer_r
: GAACGCACCTCATCTGAACTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: RH-map
Primer_f	: CAGCTTATCCGGCGACATGAG
Primer_r	: TGTTCCGCTTTGATTTTCTCG
PCR product length	: 107(1.6k) bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	YES	YES
Warning for coding interruption:	YES	NO

Length of 3'UTR	0 bp
Genome contig ID	gi42406306f_45600207
PolyA signal sequence (None)	+--------+--------+----*----+---- GCCCCGGGCGCGGGACCGGCCCAAGCCGCGACGGC
Flanking genome sequence (168097 - 168146)	----+--------+--------+--------+--------+----* GGCCGCGGCCCAGAGAGGGTGGTGAGGGCGGGGGAAGCCGGCGCTCGCGC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	f	45700207	45768302	24	100.0	Perfect prediction

Primer_f	: TCGCTGTCTACCGCATGTTTG
Primer_r	: GAACGCACCTCATCTGAACTG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1642

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information