HUGE

Gene/Protein Characteristic Table for KIAA0728

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04834
Accession No. :	AB018271
Description :	Bullous pemphigoid antigen 1, isoforms 1/2/3/4/5/8 (Fragment).
HUGO Gene Name :	dystonin (DST)
Clone Name :	fh22477 [Vector Info]
Source :	Human fetal brain
Note :	We replaced hk03530, former representative clones for KIAA0728 with fh22477. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 5680 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 766 bp

Genome contig ID gi89161210r_56330996
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
AGAAAGCTATGAAATAAAACACGTCCCTTAACTGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTGCTATGGAATTAATTTTTTTTCCCCAGGGAAAACTAGTGTATTTTTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 r 56430996 56488311 31 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 1637 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_056363	100.0	dystonin isofor...	Homo sapiens
O94833	100.0	Bullous pemphig...	Homo sapiens
NP_899236	100.0	dystonin isofor...	Homo sapiens
NP_001138243	100.0	dystonin isofor...	Homo sapiens
NP_001138242	100.0	dystonin isofor...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007934	0	67.1	KIAA0465
AB023228	3.3e-15	19.9	KIAA1011
AB018339	2.1e-09	20.3	KIAA0796
AB008567	6.6e-09	21.7	KIAA0302
AB033077	4.9e-07	20.3	KIAA1251

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR002048 1260 1314 PD000012 Calcium-binding EF-hand

HMMPfam IPR002017 1 96 PF00435 Spectrin repeat

IPR002017 99 209 PF00435 Spectrin repeat

IPR002017 239 318 PF00435 Spectrin repeat

IPR002017 321 428 PF00435 Spectrin repeat

IPR002017 431 537 PF00435 Spectrin repeat

IPR002017 540 646 PF00435 Spectrin repeat

IPR002017 649 755 PF00435 Spectrin repeat

IPR002017 758 865 PF00435 Spectrin repeat

IPR002017 872 973 PF00435 Spectrin repeat

IPR002017 976 1082 PF00435 Spectrin repeat

IPR002017 1085 1222 PF00435 Spectrin repeat

IPR002048 1255 1283 PF00036 Calcium-binding EF-hand

IPR002048 1291 1319 PF00036 Calcium-binding EF-hand

IPR003108 1330 1408 PF02187 Growth-arrest-specific protein 2

HMMSmart IPR002017 1 95 SM00150 Spectrin repeat

IPR002017 102 208 SM00150 Spectrin repeat

IPR002017 215 317 SM00150 Spectrin repeat

IPR002017 324 427 SM00150 Spectrin repeat

IPR002017 434 536 SM00150 Spectrin repeat

IPR002017 543 645 SM00150 Spectrin repeat

IPR002017 652 754 SM00150 Spectrin repeat

IPR002017 761 864 SM00150 Spectrin repeat

IPR002017 871 972 SM00150 Spectrin repeat

IPR002017 979 1081 SM00150 Spectrin repeat

IPR002017 1091 1221 SM00150 Spectrin repeat

IPR002048 1255 1283 SM00054 Calcium-binding EF-hand

IPR002048 1291 1319 SM00054 Calcium-binding EF-hand

IPR003108 1330 1408 SM00243 Growth-arrest-specific protein 2

ProfileScan IPR002048 1251 1286 PS50222 Calcium-binding EF-hand

IPR002048 1287 1322 PS50222 Calcium-binding EF-hand

ScanRegExp IPR002048 1264 1276 PS00018 Calcium-binding EF-hand

IPR002048 1300 1312 PS00018 Calcium-binding EF-hand

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR002048	1260	1314	PD000012	Calcium-binding EF-hand
HMMPfam	IPR002017	1	96	PF00435	Spectrin repeat
IPR002017	99	209	PF00435	Spectrin repeat
IPR002017	239	318	PF00435	Spectrin repeat
IPR002017	321	428	PF00435	Spectrin repeat
IPR002017	431	537	PF00435	Spectrin repeat
IPR002017	540	646	PF00435	Spectrin repeat
IPR002017	649	755	PF00435	Spectrin repeat
IPR002017	758	865	PF00435	Spectrin repeat
IPR002017	872	973	PF00435	Spectrin repeat
IPR002017	976	1082	PF00435	Spectrin repeat
IPR002017	1085	1222	PF00435	Spectrin repeat
IPR002048	1255	1283	PF00036	Calcium-binding EF-hand
IPR002048	1291	1319	PF00036	Calcium-binding EF-hand
IPR003108	1330	1408	PF02187	Growth-arrest-specific protein 2
HMMSmart	IPR002017	1	95	SM00150	Spectrin repeat
IPR002017	102	208	SM00150	Spectrin repeat
IPR002017	215	317	SM00150	Spectrin repeat
IPR002017	324	427	SM00150	Spectrin repeat
IPR002017	434	536	SM00150	Spectrin repeat
IPR002017	543	645	SM00150	Spectrin repeat
IPR002017	652	754	SM00150	Spectrin repeat
IPR002017	761	864	SM00150	Spectrin repeat
IPR002017	871	972	SM00150	Spectrin repeat
IPR002017	979	1081	SM00150	Spectrin repeat
IPR002017	1091	1221	SM00150	Spectrin repeat
IPR002048	1255	1283	SM00054	Calcium-binding EF-hand
IPR002048	1291	1319	SM00054	Calcium-binding EF-hand
IPR003108	1330	1408	SM00243	Growth-arrest-specific protein 2
ProfileScan	IPR002048	1251	1286	PS50222	Calcium-binding EF-hand
IPR002048	1287	1322	PS50222	Calcium-binding EF-hand
ScanRegExp	IPR002048	1264	1276	PS00018	Calcium-binding EF-hand
IPR002048	1300	1312	PS00018	Calcium-binding EF-hand

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GCCACAGCACTACATCAATCC

Primer_r
: GACTGCGTGTGGGTGTGTTTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GCCACAGCACTACATCAATCC
Primer_r	: GACTGCGTGTGGGTGTGTTTG
PCR product length	: 168 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	766 bp
Genome contig ID	gi89161210r_56330996
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- AGAAAGCTATGAAATAAAACACGTCCCTTAACTGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTGCTATGGAATTAATTTTTTTTCCCCAGGGAAAACTAGTGTATTTTTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	r	56430996	56488311	31	99.9	Perfect prediction

Gene/Protein Characteristic Table for KIAA0728

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information