HUGE

Gene/Protein Characteristic Table for KIAA0796

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05621
Accession No. :	AB018339
Description :	Nesprin-1.
HUGO Gene Name :	spectrin repeat containing, nuclear envelope 1 (SYNE1)
Clone Name :	hk06116s1 [Vector Info]
Source :	Human adult brain
Note :	We replaced hk06116, former representative clones for KIAA0796 with hk06116s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 6289 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 656 bp

Genome contig ID gi89161210r_152384608
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GAAGGCTTTATGTGAAAAAAGTTGAATGTTATAGT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAGATATTTATGTATGTACAGTTTGCTAAAGCCAAGTTTTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 r 152484608 152595044 34 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 1876 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAX11976	99.9	spectrin repeat...	Homo sapiens
EAW47727	99.9	spectrin repeat...	Homo sapiens
EAW47739	99.9	spectrin repeat...	Homo sapiens
CAI42284	99.9	spectrin repeat...	Homo sapiens
Q8NF91	99.9	Nesprin-1; Nucl...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023228	4.6e-134	44.4	KIAA1011
AB018271	4.3e-09	20.3	KIAA0728
AB033088	4.1e-08	19.4	KIAA1262
AB033077	1.6e-05	19.7	KIAA1251
AB007934	9.4e-05	19.9	KIAA0465

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002017 101 206 PF00435 Spectrin repeat

IPR002017 431 532 PF00435 Spectrin repeat

IPR002017 535 639 PF00435 Spectrin repeat

IPR002017 752 856 PF00435 Spectrin repeat

IPR002017 859 961 PF00435 Spectrin repeat

IPR002017 964 1075 PF00435 Spectrin repeat

IPR002017 1078 1184 PF00435 Spectrin repeat

IPR002017 1187 1291 PF00435 Spectrin repeat

IPR002017 1519 1626 PF00435 Spectrin repeat

HMMSmart IPR002017 104 205 SM00150 Spectrin repeat

IPR002017 212 314 SM00150 Spectrin repeat

IPR002017 328 427 SM00150 Spectrin repeat

IPR002017 434 531 SM00150 Spectrin repeat

IPR002017 538 638 SM00150 Spectrin repeat

IPR002017 645 748 SM00150 Spectrin repeat

IPR002017 755 855 SM00150 Spectrin repeat

IPR002017 862 960 SM00150 Spectrin repeat

IPR002017 967 1074 SM00150 Spectrin repeat

IPR002017 1081 1183 SM00150 Spectrin repeat

IPR002017 1190 1290 SM00150 Spectrin repeat

IPR002017 1522 1625 SM00150 Spectrin repeat

ProfileScan IPR012315 1817 1876 PS51049 Klarsicht/ANC-1/syne-1 homology

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002017	101	206	PF00435	Spectrin repeat
IPR002017	431	532	PF00435	Spectrin repeat
IPR002017	535	639	PF00435	Spectrin repeat
IPR002017	752	856	PF00435	Spectrin repeat
IPR002017	859	961	PF00435	Spectrin repeat
IPR002017	964	1075	PF00435	Spectrin repeat
IPR002017	1078	1184	PF00435	Spectrin repeat
IPR002017	1187	1291	PF00435	Spectrin repeat
IPR002017	1519	1626	PF00435	Spectrin repeat
HMMSmart	IPR002017	104	205	SM00150	Spectrin repeat
IPR002017	212	314	SM00150	Spectrin repeat
IPR002017	328	427	SM00150	Spectrin repeat
IPR002017	434	531	SM00150	Spectrin repeat
IPR002017	538	638	SM00150	Spectrin repeat
IPR002017	645	748	SM00150	Spectrin repeat
IPR002017	755	855	SM00150	Spectrin repeat
IPR002017	862	960	SM00150	Spectrin repeat
IPR002017	967	1074	SM00150	Spectrin repeat
IPR002017	1081	1183	SM00150	Spectrin repeat
IPR002017	1190	1290	SM00150	Spectrin repeat
IPR002017	1522	1625	SM00150	Spectrin repeat
ProfileScan	IPR012315	1817	1876	PS51049	Klarsicht/ANC-1/syne-1 homology

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 1821 FRVLRAALPLQLLLLLLIGLACL 1843 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1821	FRVLRAALPLQLLLLLLIGLACL	1843	PRIMARY	23

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CAATCTACCAACCAACCAGTG

Primer_r
: TAAAACATCATGCCCCAAAGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	656 bp
Genome contig ID	gi89161210r_152384608
PolyA signal sequence (None)	+--------+--------+----*----+---- GAAGGCTTTATGTGAAAAAAGTTGAATGTTATAGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAGATATTTATGTATGTACAGTTTGCTAAAGCCAAGTTTTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	r	152484608	152595044	34	99.9	Perfect prediction

Primer_f	: CAATCTACCAACCAACCAGTG
Primer_r	: TAAAACATCATGCCCCAAAGG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0796

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information