HUGE

Gene/Protein Characteristic Table for KIAA1011

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07039
Accession No. :	AB023228
Description :	Nesprin-2.
HUGO Gene Name :	spectrin repeat containing, nuclear envelope 2 (SYNE2)
Clone Name :	ff02850 [Vector Info]
Source :	Human fetal brain
Note :	We replaced hj05612 and fj05552, former representative clones for KIAA1011 with ff02850. (2002/5/10,2005/08/06)

Features of the cloned DNA sequence	Description

Length: 11532 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 906 bp

Genome contig ID gi51511730f_63499253
PolyA signal sequence
(ATTAAA,-22)
+----*----+----*----+----*----+----
TCAGATGTTTCTCATTAAAAAACAAAATTAGCCAG
Flanking genome sequence
(263652 - 263701)
----+----*----+----*----+----*----+----*----+----*
ACTTCTGTTGTACTGAATTCTGTAACAAAGCAGTTCAGTGGTATGCTTAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 14 f 63599253 63762903 67 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 3541 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_878918	100.0	spectrin repeat...	Homo sapiens
EAW80843	99.3	spectrin repeat...	Homo sapiens
Q8WXH0	99.3	Nesprin-2; Nucl...	Homo sapiens
EAW80842	99.3	spectrin repeat...	Homo sapiens
AAL33548	99.3	NUANCE [Homo sa...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018339	2.8e-134	44.5	KIAA0796
AB033088	1.8e-16	29.6	KIAA1262
AB007934	1.3e-14	19.7	KIAA0465
AB018271	2e-13	19.7	KIAA0728
AB008567	0.00016	20.3	KIAA0302

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002017 1578 1687 PF00435 Spectrin repeat

IPR002017 1688 1801 PF00435 Spectrin repeat

IPR002017 1804 1908 PF00435 Spectrin repeat

IPR002017 2551 2653 PF00435 Spectrin repeat

IPR002017 2656 2767 PF00435 Spectrin repeat

IPR002017 2770 2876 PF00435 Spectrin repeat

IPR002017 2879 2983 PF00435 Spectrin repeat

IPR002017 3208 3315 PF00435 Spectrin repeat

IPR002017 3318 3426 PF00435 Spectrin repeat

HMMSmart IPR002017 320 415 SM00150 Spectrin repeat

IPR002017 1475 1574 SM00150 Spectrin repeat

IPR002017 1581 1686 SM00150 Spectrin repeat

IPR002017 1696 1800 SM00150 Spectrin repeat

IPR002017 1807 1907 SM00150 Spectrin repeat

IPR002017 1913 2015 SM00150 Spectrin repeat

IPR002017 2230 2330 SM00150 Spectrin repeat

IPR002017 2447 2547 SM00150 Spectrin repeat

IPR002017 2554 2652 SM00150 Spectrin repeat

IPR002017 2659 2766 SM00150 Spectrin repeat

IPR002017 2773 2875 SM00150 Spectrin repeat

IPR002017 2882 2982 SM00150 Spectrin repeat

IPR002017 3211 3314 SM00150 Spectrin repeat

IPR002017 3321 3425 SM00150 Spectrin repeat

ProfileScan IPR012315 3482 3541 PS51049 Klarsicht/ANC-1/syne-1 homology

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002017	1578	1687	PF00435	Spectrin repeat
IPR002017	1688	1801	PF00435	Spectrin repeat
IPR002017	1804	1908	PF00435	Spectrin repeat
IPR002017	2551	2653	PF00435	Spectrin repeat
IPR002017	2656	2767	PF00435	Spectrin repeat
IPR002017	2770	2876	PF00435	Spectrin repeat
IPR002017	2879	2983	PF00435	Spectrin repeat
IPR002017	3208	3315	PF00435	Spectrin repeat
IPR002017	3318	3426	PF00435	Spectrin repeat
HMMSmart	IPR002017	320	415	SM00150	Spectrin repeat
IPR002017	1475	1574	SM00150	Spectrin repeat
IPR002017	1581	1686	SM00150	Spectrin repeat
IPR002017	1696	1800	SM00150	Spectrin repeat
IPR002017	1807	1907	SM00150	Spectrin repeat
IPR002017	1913	2015	SM00150	Spectrin repeat
IPR002017	2230	2330	SM00150	Spectrin repeat
IPR002017	2447	2547	SM00150	Spectrin repeat
IPR002017	2554	2652	SM00150	Spectrin repeat
IPR002017	2659	2766	SM00150	Spectrin repeat
IPR002017	2773	2875	SM00150	Spectrin repeat
IPR002017	2882	2982	SM00150	Spectrin repeat
IPR002017	3211	3314	SM00150	Spectrin repeat
IPR002017	3321	3425	SM00150	Spectrin repeat
ProfileScan	IPR012315	3482	3541	PS51049	Klarsicht/ANC-1/syne-1 homology

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 3491 AALPLQLLLLLLLLLACLLPSS 3512 PRIMARY 22

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	3491	AALPLQLLLLLLLLLACLLPSS	3512	PRIMARY	22

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ATGTTCTGTTCAGTACCTAGC

Primer_r
: ACATTAGTCAAAAGCTCCAGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ATGTTCTGTTCAGTACCTAGC
Primer_r	: ACATTAGTCAAAAGCTCCAGC
PCR product length	: 179 bp
PCR conditions	: 95 °C15 sec62 °C60 sec35 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	906 bp
Genome contig ID	gi51511730f_63499253
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- TCAGATGTTTCTCATTAAAAAACAAAATTAGCCAG
Flanking genome sequence (263652 - 263701)	----+--------+--------+--------+--------+----* ACTTCTGTTGTACTGAATTCTGTAACAAAGCAGTTCAGTGGTATGCTTAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	14	f	63599253	63762903	67	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA1011

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information