HUGE |
Gene/Protein Characteristic Table for KIAA0465 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | ORK05604 |
---|---|
Accession No. : | AB007934 |
Description : | Microtubule-actin cross-linking factor 1, isoforms 1/2/3/5. |
HUGO Gene Name : | microtubule-actin crosslinking factor 1 (MACF1) |
Clone Name : | hg01123s2 [Vector Info] |
Source : | Human adult brain |
Note : | We replaced hg01123 and pf00419, former representative clones for KIAA0465 with hg01123s2. (2002/5/10,2003/8/28) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 14491 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1188 bp Genome contig ID gi89161185f_39438573 PolyA signal sequence
(ATTAAA,-21) +----*----+----*----+----*----+----
AGACACACTTTTGTATTAAAATTGCTTGCAGTAACFlanking genome sequence
(286670 - 286719) ----+----*----+----*----+----*----+----*----+----*
AAATATTTTGTATTTCCTGATTTTCTTTTCAACTATTACCTTATCTATAA
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 f 39538573 39725241 70 99.9 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 4433 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RH mapping information |
Description | |
---|---|---|
: 1 |
: GeneBridge 4 | |
: CCTTTTCATGGTCACTTGGTC | |
: ACCAGCACACTTGTTAACCAG | |
: 85 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |