HUGE

Gene/Protein Characteristic Table for KIAA0465

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK05604
Accession No. :	AB007934
Description :	Microtubule-actin cross-linking factor 1, isoforms 1/2/3/5.
HUGO Gene Name :	microtubule-actin crosslinking factor 1 (MACF1)
Clone Name :	hg01123s2 [Vector Info]
Source :	Human adult brain
Note :	We replaced hg01123 and pf00419, former representative clones for KIAA0465 with hg01123s2. (2002/5/10,2003/8/28)

Features of the cloned DNA sequence	Description

Length: 14491 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1188 bp

Genome contig ID gi89161185f_39438573
PolyA signal sequence
(ATTAAA,-21)
+----*----+----*----+----*----+----
AGACACACTTTTGTATTAAAATTGCTTGCAGTAAC
Flanking genome sequence
(286670 - 286719)
----+----*----+----*----+----*----+----*----+----*
AAATATTTTGTATTTCCTGATTTTCTTTTCAACTATTACCTTATCTATAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 39538573 39725241 70 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 4433 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAM20971	91.7	microtubule-act...	Mus musculus
EDL30377	91.1	mCG1040588, iso...	Mus musculus
CAM20969	91.0	microtubule-act...	Mus musculus
CAM20970	79.2	microtubule-act...	Mus musculus
Q9QXZ0	90.4	Microtubule-act...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033077	0	100.0	KIAA1251
AB018271	5.2e-172	67.1	KIAA0728
AB023228	1.1e-10	19.6	KIAA1011
AB033088	1.7e-06	19.4	KIAA1262
AB002334	0.0002	20.7	KIAA0336

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR002048 4095 4149 PD000012 Calcium-binding EF-hand

HMMPfam IPR002017 680 792 PF00435 Spectrin repeat

IPR002017 948 1024 PF00435 Spectrin repeat

IPR002017 1065 1175 PF00435 Spectrin repeat

IPR002017 1178 1284 PF00435 Spectrin repeat

IPR002017 1393 1507 PF00435 Spectrin repeat

IPR002017 1510 1619 PF00435 Spectrin repeat

IPR002017 1622 1730 PF00435 Spectrin repeat

IPR002017 1843 1950 PF00435 Spectrin repeat

IPR002017 1953 2057 PF00435 Spectrin repeat

IPR002017 2309 2386 PF00435 Spectrin repeat

IPR002017 2389 2495 PF00435 Spectrin repeat

IPR002017 2498 2604 PF00435 Spectrin repeat

IPR002017 2607 2713 PF00435 Spectrin repeat

IPR002017 2716 2822 PF00435 Spectrin repeat

IPR002017 2825 2930 PF00435 Spectrin repeat

IPR002017 2936 3046 PF00435 Spectrin repeat

IPR002017 3049 3155 PF00435 Spectrin repeat

IPR002017 3158 3265 PF00435 Spectrin repeat

IPR002017 3268 3374 PF00435 Spectrin repeat

IPR002017 3377 3484 PF00435 Spectrin repeat

IPR002017 3487 3593 PF00435 Spectrin repeat

IPR002017 3596 3703 PF00435 Spectrin repeat

IPR002017 3710 3811 PF00435 Spectrin repeat

IPR002017 3814 3920 PF00435 Spectrin repeat

IPR002017 3923 4057 PF00435 Spectrin repeat

IPR002048 4090 4118 PF00036 Calcium-binding EF-hand

IPR002048 4126 4154 PF00036 Calcium-binding EF-hand

IPR003108 4165 4237 PF02187 Growth-arrest-specific protein 2

HMMSmart IPR002017 411 540 SM00150 Spectrin repeat

IPR002017 558 666 SM00150 Spectrin repeat

IPR002017 683 791 SM00150 Spectrin repeat

IPR002017 951 1061 SM00150 Spectrin repeat

IPR002017 1068 1174 SM00150 Spectrin repeat

IPR002017 1181 1283 SM00150 Spectrin repeat

IPR002017 1290 1389 SM00150 Spectrin repeat

IPR002017 1396 1506 SM00150 Spectrin repeat

IPR002017 1513 1618 SM00150 Spectrin repeat

IPR002017 1625 1729 SM00150 Spectrin repeat

IPR002017 1736 1839 SM00150 Spectrin repeat

IPR002017 1846 1949 SM00150 Spectrin repeat

IPR002017 1956 2056 SM00150 Spectrin repeat

IPR002017 2172 2274 SM00150 Spectrin repeat

IPR002017 2281 2385 SM00150 Spectrin repeat

IPR002017 2392 2494 SM00150 Spectrin repeat

IPR002017 2501 2603 SM00150 Spectrin repeat

IPR002017 2610 2712 SM00150 Spectrin repeat

IPR002017 2719 2821 SM00150 Spectrin repeat

IPR002017 2828 2929 SM00150 Spectrin repeat

IPR002017 2939 3045 SM00150 Spectrin repeat

IPR002017 3052 3154 SM00150 Spectrin repeat

IPR002017 3161 3264 SM00150 Spectrin repeat

IPR002017 3271 3373 SM00150 Spectrin repeat

IPR002017 3380 3483 SM00150 Spectrin repeat

IPR002017 3490 3592 SM00150 Spectrin repeat

IPR002017 3599 3702 SM00150 Spectrin repeat

IPR002017 3709 3810 SM00150 Spectrin repeat

IPR002017 3817 3919 SM00150 Spectrin repeat

IPR002017 3926 4056 SM00150 Spectrin repeat

IPR002048 4090 4118 SM00054 Calcium-binding EF-hand

IPR002048 4126 4154 SM00054 Calcium-binding EF-hand

IPR003108 4165 4237 SM00243 Growth-arrest-specific protein 2

ProfileScan IPR002048 4086 4121 PS50222 Calcium-binding EF-hand

IPR002048 4122 4157 PS50222 Calcium-binding EF-hand

ScanRegExp IPR001547 2662 2671 PS00659 Glycoside hydrolase

IPR002048 4099 4111 PS00018 Calcium-binding EF-hand

IPR002048 4135 4147 PS00018 Calcium-binding EF-hand

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR002048	4095	4149	PD000012	Calcium-binding EF-hand
HMMPfam	IPR002017	680	792	PF00435	Spectrin repeat
IPR002017	948	1024	PF00435	Spectrin repeat
IPR002017	1065	1175	PF00435	Spectrin repeat
IPR002017	1178	1284	PF00435	Spectrin repeat
IPR002017	1393	1507	PF00435	Spectrin repeat
IPR002017	1510	1619	PF00435	Spectrin repeat
IPR002017	1622	1730	PF00435	Spectrin repeat
IPR002017	1843	1950	PF00435	Spectrin repeat
IPR002017	1953	2057	PF00435	Spectrin repeat
IPR002017	2309	2386	PF00435	Spectrin repeat
IPR002017	2389	2495	PF00435	Spectrin repeat
IPR002017	2498	2604	PF00435	Spectrin repeat
IPR002017	2607	2713	PF00435	Spectrin repeat
IPR002017	2716	2822	PF00435	Spectrin repeat
IPR002017	2825	2930	PF00435	Spectrin repeat
IPR002017	2936	3046	PF00435	Spectrin repeat
IPR002017	3049	3155	PF00435	Spectrin repeat
IPR002017	3158	3265	PF00435	Spectrin repeat
IPR002017	3268	3374	PF00435	Spectrin repeat
IPR002017	3377	3484	PF00435	Spectrin repeat
IPR002017	3487	3593	PF00435	Spectrin repeat
IPR002017	3596	3703	PF00435	Spectrin repeat
IPR002017	3710	3811	PF00435	Spectrin repeat
IPR002017	3814	3920	PF00435	Spectrin repeat
IPR002017	3923	4057	PF00435	Spectrin repeat
IPR002048	4090	4118	PF00036	Calcium-binding EF-hand
IPR002048	4126	4154	PF00036	Calcium-binding EF-hand
IPR003108	4165	4237	PF02187	Growth-arrest-specific protein 2
HMMSmart	IPR002017	411	540	SM00150	Spectrin repeat
IPR002017	558	666	SM00150	Spectrin repeat
IPR002017	683	791	SM00150	Spectrin repeat
IPR002017	951	1061	SM00150	Spectrin repeat
IPR002017	1068	1174	SM00150	Spectrin repeat
IPR002017	1181	1283	SM00150	Spectrin repeat
IPR002017	1290	1389	SM00150	Spectrin repeat
IPR002017	1396	1506	SM00150	Spectrin repeat
IPR002017	1513	1618	SM00150	Spectrin repeat
IPR002017	1625	1729	SM00150	Spectrin repeat
IPR002017	1736	1839	SM00150	Spectrin repeat
IPR002017	1846	1949	SM00150	Spectrin repeat
IPR002017	1956	2056	SM00150	Spectrin repeat
IPR002017	2172	2274	SM00150	Spectrin repeat
IPR002017	2281	2385	SM00150	Spectrin repeat
IPR002017	2392	2494	SM00150	Spectrin repeat
IPR002017	2501	2603	SM00150	Spectrin repeat
IPR002017	2610	2712	SM00150	Spectrin repeat
IPR002017	2719	2821	SM00150	Spectrin repeat
IPR002017	2828	2929	SM00150	Spectrin repeat
IPR002017	2939	3045	SM00150	Spectrin repeat
IPR002017	3052	3154	SM00150	Spectrin repeat
IPR002017	3161	3264	SM00150	Spectrin repeat
IPR002017	3271	3373	SM00150	Spectrin repeat
IPR002017	3380	3483	SM00150	Spectrin repeat
IPR002017	3490	3592	SM00150	Spectrin repeat
IPR002017	3599	3702	SM00150	Spectrin repeat
IPR002017	3709	3810	SM00150	Spectrin repeat
IPR002017	3817	3919	SM00150	Spectrin repeat
IPR002017	3926	4056	SM00150	Spectrin repeat
IPR002048	4090	4118	SM00054	Calcium-binding EF-hand
IPR002048	4126	4154	SM00054	Calcium-binding EF-hand
IPR003108	4165	4237	SM00243	Growth-arrest-specific protein 2
ProfileScan	IPR002048	4086	4121	PS50222	Calcium-binding EF-hand
IPR002048	4122	4157	PS50222	Calcium-binding EF-hand
ScanRegExp	IPR001547	2662	2671	PS00659	Glycoside hydrolase
IPR002048	4099	4111	PS00018	Calcium-binding EF-hand
IPR002048	4135	4147	PS00018	Calcium-binding EF-hand

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CCTTTTCATGGTCACTTGGTC
Primer_r	: ACCAGCACACTTGTTAACCAG
PCR product length	: 85 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1188 bp
Genome contig ID	gi89161185f_39438573
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- AGACACACTTTTGTATTAAAATTGCTTGCAGTAAC
Flanking genome sequence (286670 - 286719)	----+--------+--------+--------+--------+----* AAATATTTTGTATTTCCTGATTTTCTTTTCAACTATTACCTTATCTATAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	39538573	39725241	70	99.9	Perfect prediction

Gene/Protein Characteristic Table for KIAA0465

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information