HUGE

Gene/Protein Characteristic Table for KIAA1251

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05904
Accession No. :	AB033077
Description :	Microtubule-actin cross-linking factor 1, isoforms 1/2/3/5.
HUGO Gene Name :
Clone Name :	hh07943 [Vector Info]
Source :	Human adult brain
Note :	Please refer to "Gene/Protein Characteristic Table for KIAA0465" because the cDNA sequence of KIAA1251 is included in KIAA0465.

Features of the cloned DNA sequence	Description

Length: 5304 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 851 bp

Genome contig ID gi89161185f_39438573
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CCTGGGCAACAGACAGAGTGAGACTCCATCTCAGG
Flanking genome sequence
(173161 - 173210)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAAAAAAAAAGTTGGGAAAGCCTGGGTAGGTA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 39538573 39611732 26 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 1483 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAX07275	100.0	microtubule-act...	Homo sapiens
EAX07277	100.0	microtubule-act...	Homo sapiens
EAX07274	100.0	microtubule-act...	Homo sapiens
EAX07282	100.0	microtubule-act...	Homo sapiens
Q9UPN3	100.0	Microtubule-act...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007934	0	100.0	KIAA0465
AB018271	1.5e-05	20.4	KIAA0728
AB020673	0.00015	20.8	KIAA0866
AB018339	0.00019	19.2	KIAA0796

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002017 680 792 PF00435 Spectrin repeat

IPR002017 948 1024 PF00435 Spectrin repeat

IPR002017 1065 1175 PF00435 Spectrin repeat

IPR002017 1178 1284 PF00435 Spectrin repeat

HMMSmart IPR002017 411 540 SM00150 Spectrin repeat

IPR002017 558 666 SM00150 Spectrin repeat

IPR002017 683 791 SM00150 Spectrin repeat

IPR002017 951 1061 SM00150 Spectrin repeat

IPR002017 1068 1174 SM00150 Spectrin repeat

IPR002017 1181 1283 SM00150 Spectrin repeat

IPR002017 1290 1389 SM00150 Spectrin repeat

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002017	680	792	PF00435	Spectrin repeat
IPR002017	948	1024	PF00435	Spectrin repeat
IPR002017	1065	1175	PF00435	Spectrin repeat
IPR002017	1178	1284	PF00435	Spectrin repeat
HMMSmart	IPR002017	411	540	SM00150	Spectrin repeat
IPR002017	558	666	SM00150	Spectrin repeat
IPR002017	683	791	SM00150	Spectrin repeat
IPR002017	951	1061	SM00150	Spectrin repeat
IPR002017	1068	1174	SM00150	Spectrin repeat
IPR002017	1181	1283	SM00150	Spectrin repeat
IPR002017	1290	1389	SM00150	Spectrin repeat

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGATTCCCAAGGCAAGACAGG

Primer_r
: TAGCAAAAGGGGTGACAGGTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TGATTCCCAAGGCAAGACAGG
Primer_r	: TAGCAAAAGGGGTGACAGGTC
PCR product length	: 187 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	851 bp
Genome contig ID	gi89161185f_39438573
PolyA signal sequence (None)	+--------+--------+----*----+---- CCTGGGCAACAGACAGAGTGAGACTCCATCTCAGG
Flanking genome sequence (173161 - 173210)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAAAAAAAAGTTGGGAAAGCCTGGGTAGGTA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	39538573	39611732	26	99.8	Perfect prediction

Gene/Protein Characteristic Table for KIAA1251

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information