HUGE

Gene/Protein Characteristic Table for KIAA0910

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01136
Accession No. :	AB020717
Description :	Synaptojanin-1.
HUGO Gene Name :
Clone Name :	hg02207s1 [Vector Info]
Flexi ORF Clone :	pF1KA0910
Source :	Human adult brain
Note :	We replaced hg02207, former representative clones for KIAA0910 with hg02207s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 6997 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 3048 bp

Genome contig ID gi51511750r_32822944
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
GTGCTGTCATATGAAATAAATATATCTGTCTTTAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CATGCTGACTTCTTTGTTAGAAAGGGAAGAATTTTTCTCAGCCATTTTCC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 21 r 32922944 33022105 33 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 1315 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11257	100.0	synaptojanin-1 ...	synthetic construct
EDM10704	92.0	synaptojanin 1,...	Rattus norvegicus
XP_531429	96.3	synaptojanin 1 ...	Pan troglodytes
NP_982271	98.8	synaptojanin 1 ...	Homo sapiens
O43426	97.5	Synaptojanin-1;...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002346	1.5e-63	47.6	KIAA0348
AB020658	4.3e-08	30.6	KIAA0851
AB023183	5.4e-07	32.9	KIAA0966

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002013 95 383 PF02383 Synaptojanin

IPR005135 571 902 PF03372 Endonuclease/exonuclease/phosphatase

IPR015047 903 1045 PF08952 Domain of unknown function DUF1866

HMMSmart IPR000300 567 910 SM00128 Inositol polyphosphate related phosphatase

ProfileScan IPR002013 155 478 PS50275 Synaptojanin

IPR000504 938 1007 PS50102 RNA recognition motif

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002013	95	383	PF02383	Synaptojanin
IPR005135	571	902	PF03372	Endonuclease/exonuclease/phosphatase
IPR015047	903	1045	PF08952	Domain of unknown function DUF1866
HMMSmart	IPR000300	567	910	SM00128	Inositol polyphosphate related phosphatase
ProfileScan	IPR002013	155	478	PS50275	Synaptojanin
IPR000504	938	1007	PS50102	RNA recognition motif

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AAGGCACATACCACCAAGTTC

Primer_r
: TAGATGTGTTATGTAGCCTCG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 21

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ATCAGCAGCCCAGCCTTTATC
Primer_r	: ACAGAGTTCACAAAGAGATCC
PCR product length	: 183 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	3048 bp
Genome contig ID	gi51511750r_32822944
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- GTGCTGTCATATGAAATAAATATATCTGTCTTTAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CATGCTGACTTCTTTGTTAGAAAGGGAAGAATTTTTCTCAGCCATTTTCC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	21	r	32922944	33022105	33	99.5	Perfect prediction

Primer_f	: AAGGCACATACCACCAAGTTC
Primer_r	: TAGATGTGTTATGTAGCCTCG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0910

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information