HUGE

Gene/Protein Characteristic Table for KIAA0966

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01139
Accession No. :	AB023183
Description :	inositol polyphosphate-5-phosphatase F.
HUGO Gene Name :	inositol polyphosphate-5-phosphatase F (INPP5F)
Clone Name :	hj06369 [Vector Info]
Flexi ORF Clone :	pF1KA0966
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4924 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1359 bp

Genome contig ID gi89161187f_121375599
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
CTTGTGATTATTAAAATAAAGTACCATTGTAATTT
Flanking genome sequence
(203045 - 203094)
----+----*----+----*----+----*----+----*----+----*
AAAGTGACAAATGGGTATGAGAATTCCTTGCATAACAGATTAAAGAATTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 10 f 121475599 121578642 20 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 1150 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9Y2H2	100.0	Phosphatidylino...	Homo sapiens
AAI11494	99.8	Inositol polyph...	Homo sapiens
XP_508074	99.6	inositol polyph...	Pan troglodytes
XP_001099262	98.0	similar to inos...	Macaca mulatta
XP_001927491	94.1	inositol polyph...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020658	1.3e-37	38.0	KIAA0851
AB020717	1.1e-22	33.0	KIAA0910
AB002346	4.3e-22	32.1	KIAA0348
D87464	4.3e-07	25.8	KIAA0274

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002013 66 440 PF02383 Synaptojanin

ProfileScan IPR002013 185 536 PS50275 Synaptojanin

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002013	66	440	PF02383	Synaptojanin
ProfileScan	IPR002013	185	536	PS50275	Synaptojanin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGCAGATGCTTAGGGGATTAG

Primer_r
: GTCAATAACCCTCAACTCCTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 10

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1359 bp
Genome contig ID	gi89161187f_121375599
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- CTTGTGATTATTAAAATAAAGTACCATTGTAATTT
Flanking genome sequence (203045 - 203094)	----+--------+--------+--------+--------+----* AAAGTGACAAATGGGTATGAGAATTCCTTGCATAACAGATTAAAGAATTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	10	f	121475599	121578642	20	99.5	Perfect prediction

Primer_f	: TGCAGATGCTTAGGGGATTAG
Primer_r	: GTCAATAACCCTCAACTCCTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0966

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information