HUGE

Gene/Protein Characteristic Table for KIAA0274

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05023
Accession No. :	D87464
Description :	SAC domain-containing protein 3.
HUGO Gene Name :
Clone Name :	ha06690 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 3010 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 162 bp

Genome contig ID gi89161210f_110019208
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
TTCCAAATTATAGCTAATAAAGATGACTAGATAAC
Flanking genome sequence
(234116 - 234165)
----+----*----+----*----+----*----+----*----+----*
TTTGCTGTTGTTGCCTTTGCTTTATTTTAGAAATACTTTGTTTACAAATG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 f 110119208 110253322 23 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 932 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_001108096	99.8	FIG4 homolog [P...	Pan troglodytes
BAF84360	99.6	unnamed protein...	Homo sapiens
BAD96452	99.6	Sac domain-cont...	Homo sapiens
NP_001108097	98.0	FIG4 homolog [C...	Canis lupus fam...
AAI14695	96.9	FIG4 homolog (S...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023183	2.5e-08	26.0	KIAA0966
AB020658	2.7e-08	28.6	KIAA0851
AB020717	8.9e-06	27.3	KIAA0910
AB002346	7.6e-05	26.8	KIAA0348

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002013 117 455 PF02383 Synaptojanin

ProfileScan IPR002013 179 572 PS50275 Synaptojanin

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002013	117	455	PF02383	Synaptojanin
ProfileScan	IPR002013	179	572	PS50275	Synaptojanin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: TCAGCCCCCAAGAGTAGACAG
Primer_r	: GCGGTTCCTGATGTACTCTCG
PCR product length	: 127 bp
PCR conditions	: 95 °C15 sec68 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	162 bp
Genome contig ID	gi89161210f_110019208
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TTCCAAATTATAGCTAATAAAGATGACTAGATAAC
Flanking genome sequence (234116 - 234165)	----+--------+--------+--------+--------+----* TTTGCTGTTGTTGCCTTTGCTTTATTTTAGAAATACTTTGTTTACAAATG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	f	110119208	110253322	23	99.9	Perfect prediction

Gene/Protein Characteristic Table for KIAA0274

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information