HUGE |
Gene/Protein Characteristic Table for KIAA0913 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | |
Product ID : | ORK07736 |
---|---|
Accession No. : | AB020720 |
Description : | |
HUGO Gene Name : | |
Clone Name : | fh07519s2 [Vector Info] |
Flexi ORF Clone : | pF1KA0913
![]() |
Source : | Human fetal brain |
Note : | We replaced hk04127, former representative clones for KIAA0913 with fh07519s2. (2008/12/19) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5919 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 273 bp Genome contig ID gi89161187f_75115388 PolyA signal sequence
(TATAAA,-21) +----*----+----*----+----*----+----
GGCATTTATAAATATATAAACTCCTTTTTTACTCTFlanking genome sequence
(116170 - 116219) ----+----*----+----*----+----*----+----*----+----*
AGTCGACCTGGGCCTTTCCCTTCTTTCCAAATTCCATGTGCAGATGAACC
Features of the protein sequence |
Description | |
---|---|---|
Length: 1881 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |