HUGE

Gene/Protein Characteristic Table for KIAA1511

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB040944
Description :	Zinc finger SWIM domain-containing protein 5.
HUGO Gene Name :	zinc finger, SWIM-type containing 5 (ZSWIM5)
Clone Name :	fg04486 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 6562 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
YES YES

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 2049 bp

Genome contig ID gi89161185r_45154665
PolyA signal sequence
(CATAAA,-19)
+----*----+----*----+----*----+----
AATAAATCATGGATCACATAAAAGATCATTTTTCT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAGCAGAAATTGTGTTCTCTCACTAAATGAAACCCATCTCTCCTTTCT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 r 45254665 45444815 14 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 1253 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_513126	99.6	zinc finger, SW...	Pan troglodytes
Q9P217	100.0	Zinc finger SWI...	Homo sapiens
Q80TC6	95.8	Zinc finger SWI...	Mus musculus
XP_853236	89.0	similar to Zinc...	Canis lupus fam...
EDL30577	95.5	zinc finger, SW...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046797	1.2e-99	74.6	KIAA1577
AB020720	1.2e-11	31.1	KIAA0913

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007527 287 324 PF04434 Zinc finger

ProfileScan IPR007527 287 324 PS50966 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007527	287	324	PF04434	Zinc finger
ProfileScan	IPR007527	287	324	PS50966	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AAGTCAGTTGGAACCAGTGTC

Primer_r
: CACATTCTAGCTATACCACCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AAGTCAGTTGGAACCAGTGTC
Primer_r	: CACATTCTAGCTATACCACCC
PCR product length	: 101 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	YES	YES
Warning for coding interruption:	YES	NO

Length of 3'UTR	2049 bp
Genome contig ID	gi89161185r_45154665
PolyA signal sequence (CATAAA,-19)	+--------+--------+----*----+---- AATAAATCATGGATCACATAAAAGATCATTTTTCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAGCAGAAATTGTGTTCTCTCACTAAATGAAACCCATCTCTCCTTTCT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	r	45254665	45444815	14	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA1511

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information