HUGE

Gene/Protein Characteristic Table for KIAA1577

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07531
Accession No. :	AB046797
Description :	Zinc finger SWIM domain-containing protein 6 (Fragment).
HUGO Gene Name :	zinc finger, SWIM-type containing 6 (ZSWIM6)
Clone Name :	fj03457 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4087 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1853 bp

Genome contig ID gi51511721f_60752928
PolyA signal sequence
(ATTAAA,-24)
+----*----+----*----+----*----+----
TTTTTGTTTTGATTAAAATTAGTTTTTTGAAAGTT
Flanking genome sequence
(124828 - 124877)
----+----*----+----*----+----*----+----*----+----*
GATTCTGCCTCCTTTATGGTATATCTCTTATTGCACCTGAATTTGGTGAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 f 60852928 60877754 10 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 743 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW51397	100.0	hCG18020 [Homo ...	Homo sapiens
NP_065979	100.0	zinc finger, SW...	Homo sapiens
XP_001492530	98.9	similar to Zinc...	Equus caballus
XP_583205	98.5	zinc finger, SW...	Bos taurus
BAC29905	98.1	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040944	0	74.6	KIAA1511
AB020720	0.0003	26.8	KIAA0913

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ATTGGGGTTCGTGCCTCCTAG

Primer_r
: GCTCACTGCAAAGGCGTAATG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 5

Experimental conditions

Panel name	: CCR
Primer_f	: AGAAAGTTTGCCGGAATGAGG
Primer_r	: AGGAGAGAGGTGAAGAGATAC
PCR product length	: 196 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1853 bp
Genome contig ID	gi51511721f_60752928
PolyA signal sequence (ATTAAA,-24)	+--------+--------+----*----+---- TTTTTGTTTTGATTAAAATTAGTTTTTTGAAAGTT
Flanking genome sequence (124828 - 124877)	----+--------+--------+--------+--------+----* GATTCTGCCTCCTTTATGGTATATCTCTTATTGCACCTGAATTTGGTGAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	f	60852928	60877754	10	100.0	Perfect prediction

Primer_f	: ATTGGGGTTCGTGCCTCCTAG
Primer_r	: GCTCACTGCAAAGGCGTAATG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1577

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information