HUGE

Gene/Protein Characteristic Table for KIAA0922

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05626
Accession No. :	AB023139
Description :
HUGO Gene Name :
Clone Name :	hh02839a [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 2505 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 132 bp

Genome contig ID gi89161207f_154643151
PolyA signal sequence
(AATAAA,-16)
+----*----+----*----+----*----+----
TTTGGCACTTTTATATGAAAATAAATTTTTTAATG
Flanking genome sequence
(134161 - 134210)
----+----*----+----*----+----*----+----*----+----*
AAATCTGGGTGCTCTGTTTTTTTTAACTCTTCATAAATCAGTGGTAAAAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 4 f 154743151 154777310 13 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 790 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG53317	100.0	unnamed protein...	Homo sapiens
CAB66866	100.0	hypothetical pr...	Homo sapiens
A2VDJ0	100.0	Transmembrane p...	Homo sapiens
NP_001124479	100.0	hypothetical pr...	Homo sapiens
XP_001499777	85.4	similar to C27F...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D87446	2.2e-07	21.6	KIAA0257

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CGTGTGCAAGGAATACTACCC

Primer_r
: ACACATTCCCACAGTAACTCG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 4

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	132 bp
Genome contig ID	gi89161207f_154643151
PolyA signal sequence (AATAAA,-16)	+--------+--------+----*----+---- TTTGGCACTTTTATATGAAAATAAATTTTTTAATG
Flanking genome sequence (134161 - 134210)	----+--------+--------+--------+--------+----* AAATCTGGGTGCTCTGTTTTTTTTAACTCTTCATAAATCAGTGGTAAAAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	4	f	154743151	154777310	13	100.0	Perfect prediction

Primer_f	: CGTGTGCAAGGAATACTACCC
Primer_r	: ACACATTCCCACAGTAACTCG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0922

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information