HUGE

Gene/Protein Characteristic Table for KIAA0932

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00687
Accession No. :	AB023149
Description :	Tolloid-like protein 2 precursor.
HUGO Gene Name :
Clone Name :	hh04016s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA0932
Source :	Human adult brain
Note :	We replaced hh04016, former representative clones for KIAA0932 with hh04016s1. (2003/8/28)

Features of the cloned DNA sequence	Description

Length: 6717 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3478 bp

Genome contig ID gi89161187r_98014356
PolyA signal sequence
(ATTAAA,-18)
+----*----+----*----+----*----+----
CTAGAAAGGATGGTTTCATTAAAGAATGTGGATTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTGATGTGTCTTGGGTTTGTATTGCTAATTCAGACCAGATGGGTCCTTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 10 r 98114356 98263623 21 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 1078 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_507953	99.3	tolloid-like 2 ...	Pan troglodytes
BAG09904	100.0	tolloid-like pr...	synthetic construct
Q9Y6L7	99.9	Tolloid-like pr...	Homo sapiens
BAF51675	93.5	tolloid-like 2 ...	Microcebus murinus
BAF51667	93.5	tolloid-like 2 ...	Eulemur macaco

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB067477	1.3e-13	25.3	KIAA1890
AB067481	5.1e-09	28.0	KIAA1894
AB023144	5.6e-06	24.2	KIAA0927
AB011539	1.9e-05	29.3	KIAA0815
AB011541	4.5e-05	36.3	KIAA0817

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001506 243 261 PR00480 Peptidase M12A

IPR001506 297 315 PR00480 Peptidase M12A

IPR001506 316 333 PR00480 Peptidase M12A

IPR001506 355 370 PR00480 Peptidase M12A

IPR001506 397 410 PR00480 Peptidase M12A

HMMPfam IPR001506 220 413 PF01400 Peptidase M12A

IPR000859 414 523 PF00431 CUB

IPR000859 527 636 PF00431 CUB

IPR013091 640 679 PF07645 EGF calcium-binding

IPR000859 683 792 PF00431 CUB

IPR006209 799 834 PF00008 EGF-like

IPR000859 839 948 PF00431 CUB

IPR000859 952 1065 PF00431 CUB

HMMSmart IPR006026 218 360 SM00235 Peptidase

IPR000859 414 526 SM00042 CUB

IPR000859 527 639 SM00042 CUB

IPR001881 639 680 SM00179 EGF-like calcium-binding

IPR006210 642 680 SM00181 EGF

IPR000859 683 795 SM00042 CUB

IPR001881 795 835 SM00179 EGF-like calcium-binding

IPR006210 798 835 SM00181 EGF

IPR000859 839 951 SM00042 CUB

IPR000859 952 1068 SM00042 CUB

ProfileScan IPR000859 414 526 PS01180 CUB

IPR000859 527 639 PS01180 CUB

IPR000742 639 680 PS50026 EGF-like

IPR000859 683 795 PS01180 CUB

IPR000742 795 835 PS50026 EGF-like

IPR000859 839 951 PS01180 CUB

IPR000859 952 1068 PS01180 CUB

ScanRegExp IPR006025 302 311 PS00142 Peptidase M

IPR001881 639 664 PS01187 EGF-like calcium-binding

IPR000152 655 666 PS00010 Aspartic acid and asparagine hydroxylation site

IPR013032 664 679 PS01186 EGF-like region

IPR001881 795 819 PS01187 EGF-like calcium-binding

IPR000152 810 821 PS00010 Aspartic acid and asparagine hydroxylation site

IPR013032 819 834 PS01186 EGF-like region

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001506	243	261	PR00480	Peptidase M12A
IPR001506	297	315	PR00480	Peptidase M12A
IPR001506	316	333	PR00480	Peptidase M12A
IPR001506	355	370	PR00480	Peptidase M12A
IPR001506	397	410	PR00480	Peptidase M12A
HMMPfam	IPR001506	220	413	PF01400	Peptidase M12A
IPR000859	414	523	PF00431	CUB
IPR000859	527	636	PF00431	CUB
IPR013091	640	679	PF07645	EGF calcium-binding
IPR000859	683	792	PF00431	CUB
IPR006209	799	834	PF00008	EGF-like
IPR000859	839	948	PF00431	CUB
IPR000859	952	1065	PF00431	CUB
HMMSmart	IPR006026	218	360	SM00235	Peptidase
IPR000859	414	526	SM00042	CUB
IPR000859	527	639	SM00042	CUB
IPR001881	639	680	SM00179	EGF-like calcium-binding
IPR006210	642	680	SM00181	EGF
IPR000859	683	795	SM00042	CUB
IPR001881	795	835	SM00179	EGF-like calcium-binding
IPR006210	798	835	SM00181	EGF
IPR000859	839	951	SM00042	CUB
IPR000859	952	1068	SM00042	CUB
ProfileScan	IPR000859	414	526	PS01180	CUB
IPR000859	527	639	PS01180	CUB
IPR000742	639	680	PS50026	EGF-like
IPR000859	683	795	PS01180	CUB
IPR000742	795	835	PS50026	EGF-like
IPR000859	839	951	PS01180	CUB
IPR000859	952	1068	PS01180	CUB
ScanRegExp	IPR006025	302	311	PS00142	Peptidase M
IPR001881	639	664	PS01187	EGF-like calcium-binding
IPR000152	655	666	PS00010	Aspartic acid and asparagine hydroxylation site
IPR013032	664	679	PS01186	EGF-like region
IPR001881	795	819	PS01187	EGF-like calcium-binding
IPR000152	810	821	PS00010	Aspartic acid and asparagine hydroxylation site
IPR013032	819	834	PS01186	EGF-like region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ACTGGAACTGGGAAACCTAAG

Primer_r
: AGTATCATTGTTTCACCGTCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 10

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ACTGGAACTGGGAAACCTAAG
Primer_r	: AGTATCATTGTTTCACCGTCC
PCR product length	: 172 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3478 bp
Genome contig ID	gi89161187r_98014356
PolyA signal sequence (ATTAAA,-18)	+--------+--------+----*----+---- CTAGAAAGGATGGTTTCATTAAAGAATGTGGATTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTGATGTGTCTTGGGTTTGTATTGCTAATTCAGACCAGATGGGTCCTTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	10	r	98114356	98263623	21	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA0932

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information