HUGE

Gene/Protein Characteristic Table for KIAA0934

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00688
Accession No. :	AB023151
Description :	Disco-interacting protein 2 homolog C.
HUGO Gene Name :
Clone Name :	pg00224 [Vector Info]
Flexi ORF Clone :	pF1KSDA0934
Source :	Human brain (hippocampus)
Note :	We replaced hh04363, former representative clones for KIAA0934 with pg00224. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 6594 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1835 bp

Genome contig ID gi89161187r_211432
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TGTTTGACTTCTGAGATCCAAGGCTGATTGTTGTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAAGTGGCACATTTAAAAAAATGTGTCTGCAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 10 r 311432 725606 37 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 1585 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9Y2E4	100.0	Disco-interacti...	Homo sapiens
AAI37788	99.3	Dip2c protein [...	Mus musculus
XP_001509877	98.7	similar to DIP2...	Ornithorhynchus...
XP_615139	98.5	similar to Disc...	Bos taurus
NP_001074895	98.7	DIP2 disco-inte...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040896	0	76.9	KIAA1463
D80006	0	81.6	KIAA0184

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR010506 36 149 PF06464 DMAP1-binding

IPR000873 380 526 PF00501 AMP-dependent synthetase and ligase

IPR000873 733 832 PF00501 AMP-dependent synthetase and ligase

IPR000873 1032 1504 PF00501 AMP-dependent synthetase and ligase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010506	36	149	PF06464	DMAP1-binding
IPR000873	380	526	PF00501	AMP-dependent synthetase and ligase
IPR000873	733	832	PF00501	AMP-dependent synthetase and ligase
IPR000873	1032	1504	PF00501	AMP-dependent synthetase and ligase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTAGGTTGGCAAATAGCACTG

Primer_r
: TTAAGACGAGGGGACGATCAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 10

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TTAGGTTGGCAAATAGCACTG
Primer_r	: TTAAGACGAGGGGACGATCAC
PCR product length	: 218 bp
PCR conditions	: 95 °C15 sec62 °C60 sec35 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	1835 bp
Genome contig ID	gi89161187r_211432
PolyA signal sequence (None)	+--------+--------+----*----+---- TGTTTGACTTCTGAGATCCAAGGCTGATTGTTGTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAGTGGCACATTTAAAAAAATGTGTCTGCAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	10	r	311432	725606	37	99.6	Perfect prediction

Gene/Protein Characteristic Table for KIAA0934

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information