HUGE

Gene/Protein Characteristic Table for KIAA0980

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00707
Accession No. :	AB023197
Description :	Ninein-like protein.
HUGO Gene Name :
Clone Name :	hj07083 [Vector Info]
Flexi ORF Clone :	pF1KSDA0980
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4848 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 625 bp

Genome contig ID gi51511747r_25281462
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TGAAATGTCATCACACTGGAAATTGTACTATATGT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAGTATAGTTTTATATTTGAAATGTATGCAAATTATGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 20 r 25381462 25514153 24 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1406 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9Y2I6	0	100.0	Ninein-like pro...	Homo sapiens
AAH36380	0	99.7	Ninein-like [Ho...	Homo sapiens
ACE78295	0	74.7	ninein-like pro...	Homo sapiens
XP_230778	2.8e-203	60.2	similar to plec...	Rattus norvegicus
CAM17134	8.2e-200	60.0	novel protein [...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046785	2.5e-28	30.1	KIAA1565
AB007914	2.5e-05	24.0	KIAA0445

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR002048 237 282 PD000012 Calcium-binding EF-hand

HMMPfam IPR002048 35 63 PF00036 Calcium-binding EF-hand

IPR002048 261 289 PF00036 Calcium-binding EF-hand

HMMSmart IPR002048 35 63 SM00054 Calcium-binding EF-hand

IPR002048 224 252 SM00054 Calcium-binding EF-hand

IPR002048 261 289 SM00054 Calcium-binding EF-hand

ProfileScan IPR002048 31 66 PS50222 Calcium-binding EF-hand

IPR002048 84 100 PS50222 Calcium-binding EF-hand

IPR002048 220 255 PS50222 Calcium-binding EF-hand

IPR002048 257 292 PS50222 Calcium-binding EF-hand

ScanRegExp IPR002048 270 282 PS00018 Calcium-binding EF-hand

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR002048	237	282	PD000012	Calcium-binding EF-hand
HMMPfam	IPR002048	35	63	PF00036	Calcium-binding EF-hand
IPR002048	261	289	PF00036	Calcium-binding EF-hand
HMMSmart	IPR002048	35	63	SM00054	Calcium-binding EF-hand
IPR002048	224	252	SM00054	Calcium-binding EF-hand
IPR002048	261	289	SM00054	Calcium-binding EF-hand
ProfileScan	IPR002048	31	66	PS50222	Calcium-binding EF-hand
IPR002048	84	100	PS50222	Calcium-binding EF-hand
IPR002048	220	255	PS50222	Calcium-binding EF-hand
IPR002048	257	292	PS50222	Calcium-binding EF-hand
ScanRegExp	IPR002048	270	282	PS00018	Calcium-binding EF-hand

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTTGCCATTTCACTGTTCTGC

Primer_r
: AGTCCACAGATAAGGTCCCCG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 20

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TTTGCCATTTCACTGTTCTGC
Primer_r	: AGTCCACAGATAAGGTCCCCG
PCR product length	: 154 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	625 bp
Genome contig ID	gi51511747r_25281462
PolyA signal sequence (None)	+--------+--------+----*----+---- TGAAATGTCATCACACTGGAAATTGTACTATATGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAGTATAGTTTTATATTTGAAATGTATGCAAATTATGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	20	r	25381462	25514153	24	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0980

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information