HUGE

Gene/Protein Characteristic Table for KIAA1565

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06152
Accession No. :	AB046785
Description :	Ninein.
HUGO Gene Name :
Clone Name :	bf00184 [Vector Info]
Source :	Human adult brain
Note :	We replaced fh21392, former representative clones for KIAA1565 with bf00184. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 8145 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 4201 bp

Genome contig ID gi51511730r_50156222
PolyA signal sequence
(AATAAA,-33)
+----*----+----*----+----*----+----
TTAATAAAGTTTCAGTGTATTTATCATTGGTCTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGAATGGTAGCATCAAAATATTTCACTAAACACATTCTACAAATGCAGAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 14 r 50256222 50367514 31 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 1313 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW65701	100.0	ninein (GSK3B i...	Homo sapiens
AAH90932	99.9	NIN protein [Ho...	Homo sapiens
XP_001098065	61.8	similar to nine...	Macaca mulatta
NP_891989	63.6	ninein isoform ...	Homo sapiens
Q8N4C6	63.6	Ninein; hNinein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023197	9.7e-27	30.2	KIAA0980
AB046781	3.5e-06	22.3	KIAA1561
AB051536	6e-05	22.0	KIAA1749
AB046821	7.4e-05	22.3	KIAA1601
AB033102	9.3e-05	22.1	KIAA1276

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002048 50 78 PF00036 Calcium-binding EF-hand

ProfileScan IPR002048 46 81 PS50222 Calcium-binding EF-hand

IPR002048 98 115 PS50222 Calcium-binding EF-hand

IPR002048 220 255 PS50222 Calcium-binding EF-hand

IPR002048 257 290 PS50222 Calcium-binding EF-hand

IPR002048 355 390 PS50222 Calcium-binding EF-hand

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002048	50	78	PF00036	Calcium-binding EF-hand
ProfileScan	IPR002048	46	81	PS50222	Calcium-binding EF-hand
IPR002048	98	115	PS50222	Calcium-binding EF-hand
IPR002048	220	255	PS50222	Calcium-binding EF-hand
IPR002048	257	290	PS50222	Calcium-binding EF-hand
IPR002048	355	390	PS50222	Calcium-binding EF-hand

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCATTTGGGGAGCTGGTCTTC

Primer_r
: GAGAGACAGAAAACCTACATG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	4201 bp
Genome contig ID	gi51511730r_50156222
PolyA signal sequence (AATAAA,-33)	+--------+--------+----*----+---- TTAATAAAGTTTCAGTGTATTTATCATTGGTCTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGAATGGTAGCATCAAAATATTTCACTAAACACATTCTACAAATGCAGAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	14	r	50256222	50367514	31	99.5	Perfect prediction

Primer_f	: TCATTTGGGGAGCTGGTCTTC
Primer_r	: GAGAGACAGAAAACCTACATG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1565

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information