HUGE |
Gene/Protein Characteristic Table for KIAA0997 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00711 |
---|---|
Accession No. : | AB023214 |
Description : | Zinc finger and BTB domain-containing protein 1. |
HUGO Gene Name : | zinc finger and BTB domain containing 1 (ZBTB1) |
Clone Name : | hk08613 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0997
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3990 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1793 bp Genome contig ID gi51511730f_63941174 PolyA signal sequence
(AATAAA,-31) +----*----+----*----+----*----+----
ACCTAATAAAATTTCCTCCTCTATATTCCAAAGTTFlanking genome sequence
(128989 - 129038) ----+----*----+----*----+----*----+----*----+----*
AAATTGTCTGTATATTACTTTTATTTATACTGTATTTTTTCCAATCTGGC
Chr f/r start end exon identity class ContigView(URL based/DAS) 14 f 64041174 64070161 3 99.1 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 646 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: GTCCTTCAGCAGCTAAACAAC | |
: TAGAACTGCCTTGTGTGCTTG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 14 |
: CCR | |
: GTCCTTCAGCAGCTAAACAAC | |
: TAGAACTGCCTTGTGTGCTTG | |
: 99 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |