HUGE

Gene/Protein Characteristic Table for KIAA1020

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00714
Accession No. :	AB028943
Description :	Hypermethylated in cancer 2 protein.
HUGO Gene Name :	hypermethylated in cancer 2 (HIC2)
Clone Name :	fg00473s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA1020
Source :	Human fetal brain
Note :	We replaced fg00473, former representative clones for KIAA1020 with fg00473s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 6793 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4715 bp

Genome contig ID gi89161203f_20001693
PolyA signal sequence
(ATTAAA,-16)
+----*----+----*----+----*----+----
GTTATTTTATGATCTTTTCATTAAAAGCTTGATTG
Flanking genome sequence
(134057 - 134106)
----+----*----+----*----+----*----+----*----+----*
AAAACTCTGGTGTGGGACCTCCATATTCTGCTTTGGCTGTTCTCTCTAGC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 22 f 20101693 20135748 3 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 638 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG09938	9.8e-211	100.0	hypermethylated...	synthetic construct
Q96JB3	2e-210	99.8	Hypermethylated...	Homo sapiens
XP_515003	2.3e-208	98.9	hypermethylated...	Pan troglodytes
AAK72951	3e-202	99.5	HIC-3 [Homo sap...	Homo sapiens
XP_001492794	4.6e-198	94.0	hypermethylated...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB095928	5.3e-10	36.8	KIAA2007
AB037852	1.3e-09	33.8	KIAA1431
AB075862	1.7e-09	33.6	KIAA1982
AB058732	1.8e-09	37.1	KIAA1829
AB075836	3.3e-09	31.8	KIAA1956

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR007087 584 607 PD000003 Zinc finger

HMMPfam IPR013069 59 166 PF00651 BTB/POZ

IPR007087 528 550 PF00096 Zinc finger

IPR007087 556 578 PF00096 Zinc finger

IPR007087 584 606 PF00096 Zinc finger

IPR007087 612 634 PF00096 Zinc finger

HMMSmart IPR000210 69 166 SM00225 BTB/POZ-like

IPR015880 465 487 SM00355 Zinc finger

IPR015880 528 550 SM00355 Zinc finger

IPR015880 556 578 SM00355 Zinc finger

IPR015880 584 606 SM00355 Zinc finger

IPR015880 612 634 SM00355 Zinc finger

ProfileScan IPR000210 69 132 PS50097 BTB/POZ-like

IPR007087 465 492 PS50157 Zinc finger

IPR007087 528 555 PS50157 Zinc finger

IPR007087 556 583 PS50157 Zinc finger

IPR007087 584 611 PS50157 Zinc finger

IPR007087 612 638 PS50157 Zinc finger

ScanRegExp IPR007087 467 487 PS00028 Zinc finger

IPR007087 530 550 PS00028 Zinc finger

IPR007087 558 578 PS00028 Zinc finger

IPR007087 586 606 PS00028 Zinc finger

IPR007087 614 634 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	584	607	PD000003	Zinc finger
HMMPfam	IPR013069	59	166	PF00651	BTB/POZ
IPR007087	528	550	PF00096	Zinc finger
IPR007087	556	578	PF00096	Zinc finger
IPR007087	584	606	PF00096	Zinc finger
IPR007087	612	634	PF00096	Zinc finger
HMMSmart	IPR000210	69	166	SM00225	BTB/POZ-like
IPR015880	465	487	SM00355	Zinc finger
IPR015880	528	550	SM00355	Zinc finger
IPR015880	556	578	SM00355	Zinc finger
IPR015880	584	606	SM00355	Zinc finger
IPR015880	612	634	SM00355	Zinc finger
ProfileScan	IPR000210	69	132	PS50097	BTB/POZ-like
IPR007087	465	492	PS50157	Zinc finger
IPR007087	528	555	PS50157	Zinc finger
IPR007087	556	583	PS50157	Zinc finger
IPR007087	584	611	PS50157	Zinc finger
IPR007087	612	638	PS50157	Zinc finger
ScanRegExp	IPR007087	467	487	PS00028	Zinc finger
IPR007087	530	550	PS00028	Zinc finger
IPR007087	558	578	PS00028	Zinc finger
IPR007087	586	606	PS00028	Zinc finger
IPR007087	614	634	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGCACTTAAGCCACATGACAC

Primer_r
: AGGCTCGATACAATACTAAGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 22

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	4715 bp
Genome contig ID	gi89161203f_20001693
PolyA signal sequence (ATTAAA,-16)	+--------+--------+----*----+---- GTTATTTTATGATCTTTTCATTAAAAGCTTGATTG
Flanking genome sequence (134057 - 134106)	----+--------+--------+--------+--------+----* AAAACTCTGGTGTGGGACCTCCATATTCTGCTTTGGCTGTTCTCTCTAGC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	22	f	20101693	20135748	3	99.0	Perfect prediction

Primer_f	: AGCACTTAAGCCACATGACAC
Primer_r	: AGGCTCGATACAATACTAAGG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1020

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information