HUGE |
Gene/Protein Characteristic Table for KIAA1006 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK02011 |
---|---|
Accession No. : | AB023223 |
Description : | Syntaxin-binding protein 5-like. |
HUGO Gene Name : | syntaxin binding protein 5-like (STXBP5L) |
Clone Name : | hk10084 [Vector Info] |
Flexi ORF Clone : | pF1KA1006
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4370 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 702 bp Genome contig ID gi89161205f_122009773 PolyA signal sequence
(AGTAAA,-19) +----*----+----*----+----*----+----
CAAATATTGCCAGTATAGTAAATTATTCCCAACACFlanking genome sequence
(611565 - 611614) ----+----*----+----*----+----*----+----*----+----*
AATCAGTTTCATTTCTATCACCTTCAGAATGGGTTGCTGTTTTTAGCACA
Chr f/r start end exon identity class ContigView(URL based/DAS) 3 f 122109773 122621336 28 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1221 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: ACGGGGAGTCCTCTTGATTTG | |
: TGAGTGTGGCCCAATTGATAG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 3 |
: GeneBridge 4 | |
: ACGGGGAGTCCTCTTGATTTG | |
: TGAGTGTGGCCCAATTGATAG | |
: 176 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |