HUGE

Gene/Protein Characteristic Table for KIAA1009

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB023226
Description :
HUGO Gene Name :
Clone Name :	hj03795 [Vector Info]
Flexi ORF Clone :	pF1KA1009
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5103 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
NO NO

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 817 bp

Genome contig ID gi89161210r_84791175
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
TTGTAAATATTGCTGCAATAAACATACATGTACAG
Flanking genome sequence
(99516 - 99467)
----+----*----+----*----+----*----+----*----+----*
ATATCTTTTTTATATAATGATTTCTGTTCCTTTGGGTAGATTCCCAGTAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 r 84890691 84994033 27 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1345 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW48644	99.7	chromosome 6 op...	Homo sapiens
XP_001086275	95.9	similar to zipp...	Macaca mulatta
XP_532220	84.0	similar to EEA1...	Canis lupus fam...
XP_001063109	74.9	similar to F58G...	Rattus norvegicus
Q4KLH6	74.8	Protein QN1 hom...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051536	0.00013	20.7	KIAA1749
AB002371	0.00061	21.9	KIAA0373
AB011140	0.0007	21.5	KIAA0568

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AAATTGAACATACTCCGCCAC

Primer_r
: GATGATGGGTACACTAGAAGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AAATTGAACATACTCCGCCAC
Primer_r	: GATGATGGGTACACTAGAAGC
PCR product length	: 143 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	NO	NO
Warning for coding interruption:	YES	NO

Length of 3'UTR	817 bp
Genome contig ID	gi89161210r_84791175
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TTGTAAATATTGCTGCAATAAACATACATGTACAG
Flanking genome sequence (99516 - 99467)	----+--------+--------+--------+--------+----* ATATCTTTTTTATATAATGATTTCTGTTCCTTTGGGTAGATTCCCAGTAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	r	84890691	84994033	27	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA1009

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information