HUGE

Gene/Protein Characteristic Table for KIAA1017

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK02013
Accession No. :	AB023234
Description :	Hermansky-Pudlak syndrome 5 protein.
HUGO Gene Name :
Clone Name :	hk07512s1 [Vector Info]
Flexi ORF Clone :	pF1KA1017
Source :	Human adult brain
Note :	We replaced hk07512, former representative clones for KIAA1017 with hk07512s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 4147 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 823 bp

Genome contig ID gi51511727r_18157458
PolyA signal sequence
(AATAAA,-30)
+----*----+----*----+----*----+----
AATTAAATAAAATATCTTCATATATAAATTAAGCT
Flanking genome sequence
(99724 - 99675)
----+----*----+----*----+----*----+----*----+----*
AATTAAAAATATTTTTCCCTGTATTTATTTAATATTTTCTAATCTGAACC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 11 r 18257182 18300297 22 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 1095 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_508314	99.6	Hermansky-Pudla...	Pan troglodytes
Q9UPZ3	99.9	Hermansky-Pudla...	Homo sapiens
BAF84352	99.8	unnamed protein...	Homo sapiens
AAO25962	100.0	HPS5 protein [H...	Homo sapiens
AAO25964	99.9	HPS5 protein mi...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002327	1.2e-14	29.6	KIAA0329
AB002295	8.8e-10	30.0	KIAA0297

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ACTCTTTATCCATGACCTCAG

Primer_r
: TAATCCACTAGCAACAAGCAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 11

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ACTCTTTATCCATGACCTCAG
Primer_r	: TAATCCACTAGCAACAAGCAG
PCR product length	: 165 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	823 bp
Genome contig ID	gi51511727r_18157458
PolyA signal sequence (AATAAA,-30)	+--------+--------+----*----+---- AATTAAATAAAATATCTTCATATATAAATTAAGCT
Flanking genome sequence (99724 - 99675)	----+--------+--------+--------+--------+----* AATTAAAAATATTTTTCCCTGTATTTATTTAATATTTTCTAATCTGAACC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	11	r	18257182	18300297	22	99.7	Perfect prediction

Gene/Protein Characteristic Table for KIAA1017

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information