HUGE

Gene/Protein Characteristic Table for KIAA0297

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05589
Accession No. :	AB002295
Description :
HUGO Gene Name :
Clone Name :	hf00325 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 8039 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4223 bp

Genome contig ID gi51511730f_101844650
PolyA signal sequence
(AATAAA,-29)
+----*----+----*----+----*----+----
TCCAAAAATAAAGCAGATTTACATTTTAAAAATTC
Flanking genome sequence
(193922 - 193971)
----+----*----+----*----+----*----+----*----+----*
AGTTGTCTCTAACTACTCTTTGTTATCAAGGCTGGTTGAGTCAAATATCA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 14 f 101944650 102038570 17 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1271 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_547986	0	84.8	similar to CG11...	Canis lupus fam...
BAE28012	0	80.5	unnamed protein...	Mus musculus
BAG61595	0	98.6	unnamed protein...	Homo sapiens
CAK11071	7.9e-187	51.3	novel protein [...	Danio rerio
CAK11070	9.8e-187	53.9	novel protein [...	Danio rerio

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002327	0	100.0	KIAA0329
AB023234	6.2e-08	30.0	KIAA1017
AB037779	7.4e-06	30.1	KIAA1358

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR006624 805 836 PF06462 Beta-propeller repeat TECPR

IPR006624 854 887 PF06462 Beta-propeller repeat TECPR

IPR006624 1039 1069 PF06462 Beta-propeller repeat TECPR

IPR006624 1086 1119 PF06462 Beta-propeller repeat TECPR

IPR006624 1139 1170 PF06462 Beta-propeller repeat TECPR

IPR006624 1182 1213 PF06462 Beta-propeller repeat TECPR

HMMSmart IPR006624 140 174 SM00706 Beta-propeller repeat TECPR

IPR006624 176 213 SM00706 Beta-propeller repeat TECPR

IPR006624 745 778 SM00706 Beta-propeller repeat TECPR

IPR006624 786 821 SM00706 Beta-propeller repeat TECPR

IPR006624 832 870 SM00706 Beta-propeller repeat TECPR

IPR006624 1020 1055 SM00706 Beta-propeller repeat TECPR

IPR006624 1063 1102 SM00706 Beta-propeller repeat TECPR

IPR006624 1113 1155 SM00706 Beta-propeller repeat TECPR

IPR006624 1164 1198 SM00706 Beta-propeller repeat TECPR

IPR006624 1207 1241 SM00706 Beta-propeller repeat TECPR

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006624	805	836	PF06462	Beta-propeller repeat TECPR
IPR006624	854	887	PF06462	Beta-propeller repeat TECPR
IPR006624	1039	1069	PF06462	Beta-propeller repeat TECPR
IPR006624	1086	1119	PF06462	Beta-propeller repeat TECPR
IPR006624	1139	1170	PF06462	Beta-propeller repeat TECPR
IPR006624	1182	1213	PF06462	Beta-propeller repeat TECPR
HMMSmart	IPR006624	140	174	SM00706	Beta-propeller repeat TECPR
IPR006624	176	213	SM00706	Beta-propeller repeat TECPR
IPR006624	745	778	SM00706	Beta-propeller repeat TECPR
IPR006624	786	821	SM00706	Beta-propeller repeat TECPR
IPR006624	832	870	SM00706	Beta-propeller repeat TECPR
IPR006624	1020	1055	SM00706	Beta-propeller repeat TECPR
IPR006624	1063	1102	SM00706	Beta-propeller repeat TECPR
IPR006624	1113	1155	SM00706	Beta-propeller repeat TECPR
IPR006624	1164	1198	SM00706	Beta-propeller repeat TECPR
IPR006624	1207	1241	SM00706	Beta-propeller repeat TECPR

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: TTGCTCACGTTAACATGGCTG

Primer_r
: CTCAAGAACAAGTCCTAGGTC

PCR conditions
: 95 °C15 sec62 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TTGCTCACGTTAACATGGCTG
Primer_r	: CTCAAGAACAAGTCCTAGGTC
PCR product length	: 104 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4223 bp
Genome contig ID	gi51511730f_101844650
PolyA signal sequence (AATAAA,-29)	+--------+--------+----*----+---- TCCAAAAATAAAGCAGATTTACATTTTAAAAATTC
Flanking genome sequence (193922 - 193971)	----+--------+--------+--------+--------+----* AGTTGTCTCTAACTACTCTTTGTTATCAAGGCTGGTTGAGTCAAATATCA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	14	f	101944650	102038570	17	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0297

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information