HUGE

Gene/Protein Characteristic Table for KIAA1358

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05655
Accession No. :	AB037779
Description :
HUGO Gene Name :
Clone Name :	fj02029 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4183 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 809 bp

Genome contig ID gi89161213r_97584112
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CTGCACTCCAGCCTGGGCGACAGAGACTCCATCTC
Flanking genome sequence
(99715 - 99666)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAGTGAAGGAAGGAGACAGCAGATTGGAAATA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 7 r 97683827 97713270 24 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 1123 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAF85685	99.7	unnamed protein...	Homo sapiens
XP_001135397	96.5	similar to DKFZ...	Pan troglodytes
XP_001135239	95.4	similar to DKFZ...	Pan troglodytes
EAW76716	100.0	DKFZP434B0335 p...	Homo sapiens
XP_546986	87.9	similar to CG32...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002295	7.3e-07	30.1	KIAA0297
AB002327	7.8e-07	30.1	KIAA0329
AB040972	0.00031	23.5	KIAA1539

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom NULL 781 874 PD718531 NULL

HMMPfam IPR006624 167 198 PF06462 Beta-propeller repeat TECPR

IPR006624 212 243 PF06462 Beta-propeller repeat TECPR

IPR006624 259 290 PF06462 Beta-propeller repeat TECPR

IPR006624 302 334 PF06462 Beta-propeller repeat TECPR

IPR006624 687 714 PF06462 Beta-propeller repeat TECPR

IPR006624 911 942 PF06462 Beta-propeller repeat TECPR

IPR006624 956 987 PF06462 Beta-propeller repeat TECPR

IPR006624 1002 1033 PF06462 Beta-propeller repeat TECPR

IPR006624 1045 1085 PF06462 Beta-propeller repeat TECPR

HMMSmart IPR006613 22 83 SM00693 Dysferlin

IPR006614 95 128 SM00694 Dysferlin

IPR006624 150 183 SM00706 Beta-propeller repeat TECPR

IPR006624 192 228 SM00706 Beta-propeller repeat TECPR

IPR006624 237 275 SM00706 Beta-propeller repeat TECPR

IPR006624 284 319 SM00706 Beta-propeller repeat TECPR

IPR006624 664 703 SM00706 Beta-propeller repeat TECPR

IPR006624 719 753 SM00706 Beta-propeller repeat TECPR

IPR006613 774 835 SM00693 Dysferlin

IPR006614 846 879 SM00694 Dysferlin

IPR006624 893 927 SM00706 Beta-propeller repeat TECPR

IPR006624 936 972 SM00706 Beta-propeller repeat TECPR

IPR006624 981 1018 SM00706 Beta-propeller repeat TECPR

IPR006624 1027 1062 SM00706 Beta-propeller repeat TECPR

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	NULL	781	874	PD718531	NULL
HMMPfam	IPR006624	167	198	PF06462	Beta-propeller repeat TECPR
IPR006624	212	243	PF06462	Beta-propeller repeat TECPR
IPR006624	259	290	PF06462	Beta-propeller repeat TECPR
IPR006624	302	334	PF06462	Beta-propeller repeat TECPR
IPR006624	687	714	PF06462	Beta-propeller repeat TECPR
IPR006624	911	942	PF06462	Beta-propeller repeat TECPR
IPR006624	956	987	PF06462	Beta-propeller repeat TECPR
IPR006624	1002	1033	PF06462	Beta-propeller repeat TECPR
IPR006624	1045	1085	PF06462	Beta-propeller repeat TECPR
HMMSmart	IPR006613	22	83	SM00693	Dysferlin
IPR006614	95	128	SM00694	Dysferlin
IPR006624	150	183	SM00706	Beta-propeller repeat TECPR
IPR006624	192	228	SM00706	Beta-propeller repeat TECPR
IPR006624	237	275	SM00706	Beta-propeller repeat TECPR
IPR006624	284	319	SM00706	Beta-propeller repeat TECPR
IPR006624	664	703	SM00706	Beta-propeller repeat TECPR
IPR006624	719	753	SM00706	Beta-propeller repeat TECPR
IPR006613	774	835	SM00693	Dysferlin
IPR006614	846	879	SM00694	Dysferlin
IPR006624	893	927	SM00706	Beta-propeller repeat TECPR
IPR006624	936	972	SM00706	Beta-propeller repeat TECPR
IPR006624	981	1018	SM00706	Beta-propeller repeat TECPR
IPR006624	1027	1062	SM00706	Beta-propeller repeat TECPR

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GACAGCATCCTCTTCATCTAC

Primer_r
: AGTCATTCATGTCCTGCTCGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GACAGCATCCTCTTCATCTAC
Primer_r	: AGTCATTCATGTCCTGCTCGG
PCR product length	: 193(600) bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	809 bp
Genome contig ID	gi89161213r_97584112
PolyA signal sequence (None)	+--------+--------+----*----+---- CTGCACTCCAGCCTGGGCGACAGAGACTCCATCTC
Flanking genome sequence (99715 - 99666)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAGTGAAGGAAGGAGACAGCAGATTGGAAATA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	7	r	97683827	97713270	24	99.8	Perfect prediction

Gene/Protein Characteristic Table for KIAA1358

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information