HUGE

Gene/Protein Characteristic Table for KIAA0329

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00052
Accession No. :	AB002327
Description :
HUGO Gene Name :
Clone Name :	hg00872 [Vector Info]
Flexi ORF Clone :	pF1KA0329
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6379 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 1417 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_547986	0	85.8	similar to CG11...	Canis lupus fam...
BAE28012	0	81.8	unnamed protein...	Mus musculus
BAC87100	0	99.8	unnamed protein...	Homo sapiens
BAG61595	0	98.6	unnamed protein...	Homo sapiens
CAK11071	1.7e-184	51.3	novel protein [...	Danio rerio

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002295	0	100.0	KIAA0297
AB023234	4.5e-12	29.6	KIAA1017
AB037779	7.7e-06	30.1	KIAA1358

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR006624 951 982 PF06462 Beta-propeller repeat TECPR

IPR006624 1000 1033 PF06462 Beta-propeller repeat TECPR

IPR006624 1185 1215 PF06462 Beta-propeller repeat TECPR

IPR006624 1232 1265 PF06462 Beta-propeller repeat TECPR

IPR006624 1285 1316 PF06462 Beta-propeller repeat TECPR

IPR006624 1328 1359 PF06462 Beta-propeller repeat TECPR

HMMSmart IPR001680 27 67 SM00320 WD40 repeat

IPR001680 71 111 SM00320 WD40 repeat

IPR001680 119 161 SM00320 WD40 repeat

IPR006624 286 320 SM00706 Beta-propeller repeat TECPR

IPR006624 322 359 SM00706 Beta-propeller repeat TECPR

IPR006624 891 924 SM00706 Beta-propeller repeat TECPR

IPR006624 932 967 SM00706 Beta-propeller repeat TECPR

IPR006624 978 1016 SM00706 Beta-propeller repeat TECPR

IPR006624 1166 1201 SM00706 Beta-propeller repeat TECPR

IPR006624 1209 1248 SM00706 Beta-propeller repeat TECPR

IPR006624 1259 1301 SM00706 Beta-propeller repeat TECPR

IPR006624 1310 1344 SM00706 Beta-propeller repeat TECPR

IPR006624 1353 1387 SM00706 Beta-propeller repeat TECPR

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006624	951	982	PF06462	Beta-propeller repeat TECPR
IPR006624	1000	1033	PF06462	Beta-propeller repeat TECPR
IPR006624	1185	1215	PF06462	Beta-propeller repeat TECPR
IPR006624	1232	1265	PF06462	Beta-propeller repeat TECPR
IPR006624	1285	1316	PF06462	Beta-propeller repeat TECPR
IPR006624	1328	1359	PF06462	Beta-propeller repeat TECPR
HMMSmart	IPR001680	27	67	SM00320	WD40 repeat
IPR001680	71	111	SM00320	WD40 repeat
IPR001680	119	161	SM00320	WD40 repeat
IPR006624	286	320	SM00706	Beta-propeller repeat TECPR
IPR006624	322	359	SM00706	Beta-propeller repeat TECPR
IPR006624	891	924	SM00706	Beta-propeller repeat TECPR
IPR006624	932	967	SM00706	Beta-propeller repeat TECPR
IPR006624	978	1016	SM00706	Beta-propeller repeat TECPR
IPR006624	1166	1201	SM00706	Beta-propeller repeat TECPR
IPR006624	1209	1248	SM00706	Beta-propeller repeat TECPR
IPR006624	1259	1301	SM00706	Beta-propeller repeat TECPR
IPR006624	1310	1344	SM00706	Beta-propeller repeat TECPR
IPR006624	1353	1387	SM00706	Beta-propeller repeat TECPR

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: AAACTGTACAAAGCACGAAGC

Primer_r
: TGTGTCTGTTGTGCCTTGCCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AAACTGTACAAAGCACGAAGC
Primer_r	: TGTGTCTGTTGTGCCTTGCCC
PCR product length	: 128 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Gene/Protein Characteristic Table for KIAA0329

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information