HUGE

Gene/Protein Characteristic Table for KIAA1061

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05236
Accession No. :	AB028984
Description :	Follistatin-related protein 4 precursor.
HUGO Gene Name :	follistatin-like 4 (FSTL4)
Clone Name :	hj00491 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4719 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2635 bp

Genome contig ID gi51511721r_132460051
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
CCCCCTCAGTCATTTTGAAATAAAATTAATTTTAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAATTCGATAGTTTTTTTTTTCCCAAAATGACAAAAAATCTGCACCTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 r 132560051 132680207 12 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 693 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_055897	100.0	follistatin-lik...	Homo sapiens
EAW62292	99.9	follistatin-lik...	Homo sapiens
Q6MZW2	99.6	Follistatin-rel...	Homo sapiens
XP_517931	99.3	follistatin-lik...	Pan troglodytes
XP_001107348	97.3	similar to foll...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033089	5.3e-170	60.5	KIAA1263
D86983	1.3e-10	29.1	KIAA0230
AB018349	1.3e-08	25.7	KIAA0806
AB002341	2.7e-08	29.3	KIAA0343
AB037776	4.1e-08	30.3	KIAA1355

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013151 114 174 PF00047 Immunoglobulin

IPR013098 192 281 PF07679 Immunoglobulin I-set

HMMSmart IPR003599 106 189 SM00409 Immunoglobulin subtype

IPR003598 112 179 SM00408 Immunoglobulin subtype 2

IPR003599 198 282 SM00409 Immunoglobulin subtype

IPR003598 204 271 SM00408 Immunoglobulin subtype 2

ProfileScan IPR002048 25 60 PS50222 Calcium-binding EF-hand

IPR007110 102 189 PS50835 Immunoglobulin-like

IPR007110 192 277 PS50835 Immunoglobulin-like

IPR007110 659 693 PS50835 Immunoglobulin-like

ScanRegExp IPR002048 38 50 PS00018 Calcium-binding EF-hand

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013151	114	174	PF00047	Immunoglobulin
IPR013098	192	281	PF07679	Immunoglobulin I-set
HMMSmart	IPR003599	106	189	SM00409	Immunoglobulin subtype
IPR003598	112	179	SM00408	Immunoglobulin subtype 2
IPR003599	198	282	SM00409	Immunoglobulin subtype
IPR003598	204	271	SM00408	Immunoglobulin subtype 2
ProfileScan	IPR002048	25	60	PS50222	Calcium-binding EF-hand
IPR007110	102	189	PS50835	Immunoglobulin-like
IPR007110	192	277	PS50835	Immunoglobulin-like
IPR007110	659	693	PS50835	Immunoglobulin-like
ScanRegExp	IPR002048	38	50	PS00018	Calcium-binding EF-hand

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CAGCAGAGGTTCATGGGACAC

Primer_r
: CATTAGGAGGATTACCGGCTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 5

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CAGCAGAGGTTCATGGGACAC
Primer_r	: CATTAGGAGGATTACCGGCTG
PCR product length	: 100 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2635 bp
Genome contig ID	gi51511721r_132460051
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- CCCCCTCAGTCATTTTGAAATAAAATTAATTTTAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAATTCGATAGTTTTTTTTTTCCCAAAATGACAAAAAATCTGCACCTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	r	132560051	132680207	12	99.3	Perfect prediction

Gene/Protein Characteristic Table for KIAA1061

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information