HUGE

Gene/Protein Characteristic Table for KIAA1093

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00738
Accession No. :	AB029016
Description :	Trinucleotide repeat-containing 6B protein.
HUGO Gene Name :	trinucleotide repeat containing 6B (TNRC6B)
Clone Name :	fh18956 [Vector Info]
Flexi ORF Clone :	pF1KSDA1093
Source :	Human fetal brain
Note :	We replaced hk06357, former representative clones for KIAA1093 with fh18956. (2001/5/29)

Features of the cloned DNA sequence	Description

Length: 5479 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 116 bp

Genome contig ID gi89161203f_38803925
PolyA signal sequence
(AATAAA,-28)
+----*----+----*----+----*----+----
AACTTGCAATAAATACATTTTTAAAAGGAAAAAAG
Flanking genome sequence
(245383 - 245432)
----+----*----+----*----+----*----+----*----+----*
AAAACGGAGAGAAAAAAAGGTGGGTCATTGACAGACTGTCTGAGCACATA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 22 f 38903892 39049306 21 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 1727 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09966	100.0	trinucleotide r...	synthetic construct
Q9UPQ9	99.9	Trinucleotide r...	Homo sapiens
EAW60373	99.9	trinucleotide r...	Homo sapiens
XP_001101111	99.4	trinucleotide r...	Macaca mulatta
XP_859340	97.2	similar to Trin...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040893	4.4e-45	38.9	KIAA1460
AB046802	3.1e-22	36.2	KIAA1582

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCTAGAAAGACAATGTGAAGC

Primer_r
: GACCTAAGGACGGAAACACAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 22

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CAGAACCAGTCAGATCCCGTG
Primer_r	: ATGAAGCGCCAGCAAGATCGG
PCR product length	: 118 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	116 bp
Genome contig ID	gi89161203f_38803925
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- AACTTGCAATAAATACATTTTTAAAAGGAAAAAAG
Flanking genome sequence (245383 - 245432)	----+--------+--------+--------+--------+----* AAAACGGAGAGAAAAAAAGGTGGGTCATTGACAGACTGTCTGAGCACATA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	22	f	38903892	39049306	21	99.8	Perfect prediction

Primer_f	: CCTAGAAAGACAATGTGAAGC
Primer_r	: GACCTAAGGACGGAAACACAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1093

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information