HUGE

Gene/Protein Characteristic Table for KIAA1460

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07178
Accession No. :	AB040893
Description :	Trinucleotide repeat-containing gene 6A protein.
HUGO Gene Name :	trinucleotide repeat containing 6A (TNRC6A)
Clone Name :	fh17570 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5273 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1070 bp

Genome contig ID gi51511732f_24609156
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ACTACATATTGCTCTGTTAAAGAATTTTCTCTGCC
Flanking genome sequence
(134543 - 134592)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAGAAAAAACAAAAAAACGCTTAAAGCTGGAGTTTGACATTCT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 16 f 24709151 24743697 20 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 1400 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAK62026	99.9	GW182 autoantig...	Homo sapiens
EAW55784	99.9	trinucleotide r...	Homo sapiens
Q8NDV7	99.9	Trinucleotide r...	Homo sapiens
NP_055309	99.9	trinucleotide r...	Homo sapiens
XP_001098013	99.2	similar to trin...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046802	1.4e-64	45.4	KIAA1582
AB029016	1.4e-59	39.1	KIAA1093

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGAGCTTTTCCCTTTGCACTG

Primer_r
: ATCCTAAGTCAGCATCCTAAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TGAGCTTTTCCCTTTGCACTG
Primer_r	: ATCCTAAGTCAGCATCCTAAC
PCR product length	: 192 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1070 bp
Genome contig ID	gi51511732f_24609156
PolyA signal sequence (None)	+--------+--------+----*----+---- ACTACATATTGCTCTGTTAAAGAATTTTCTCTGCC
Flanking genome sequence (134543 - 134592)	----+--------+--------+--------+--------+----* AAAAAAAAAGAAAAAACAAAAAAACGCTTAAAGCTGGAGTTTGACATTCT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	16	f	24709151	24743697	20	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA1460

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information