HUGE

Gene/Protein Characteristic Table for KIAA1582

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00249
Accession No. :	AB046802
Description :	Trinucleotide repeat-containing gene 6C protein.
HUGO Gene Name :	trinucleotide repeat containing 6C (TNRC6C)
Clone Name :	fj05982s1 [Vector Info]
Flexi ORF Clone :	pF1KA1582
Source :	Human fetal brain
Note :	We replaced fj05982, former representative clones for KIAA1582 with fj05982s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 5318 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 95 bp

Genome contig ID gi51511734f_73456589
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GCCCCACAGACCCGCTGGAACCCAGCAGCGGCCGC
Flanking genome sequence
(156029 - 156078)
----+----*----+----*----+----*----+----*----+----*
CCTTTTGAGTACCTCTGTCCAGGACTGAAGACGAACCTTGGCCGCAGTCC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 f 73556589 73612616 18 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 1740 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9HCJ0	100.0	Trinucleotide r...	Homo sapiens
EAW89483	99.8	trinucleotide r...	Homo sapiens
CAX15807	90.9	trinucleotide r...	Mus musculus
BAE27937	90.5	unnamed protein...	Mus musculus
CAM27640	90.5	trinucleotide r...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040893	1.8e-50	45.4	KIAA1460
AB029016	5.3e-23	36.1	KIAA1093

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000449 989 1028 PF00627 Ubiquitin-associated/Translation elongation factor EF1B

IPR000504 1566 1631 PF00076 RNA recognition motif

HMMSmart IPR000449 990 1027 SM00165 Ubiquitin-associated/Translation elongation factor EF1B

ProfileScan IPR000449 983 1028 PS50030 Ubiquitin-associated/Translation elongation factor EF1B

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000449	989	1028	PF00627	Ubiquitin-associated/Translation elongation factor EF1B
IPR000504	1566	1631	PF00076	RNA recognition motif
HMMSmart	IPR000449	990	1027	SM00165	Ubiquitin-associated/Translation elongation factor EF1B
ProfileScan	IPR000449	983	1028	PS50030	Ubiquitin-associated/Translation elongation factor EF1B

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CTGCTGGAAAAGAAGGTGGAC

Primer_r
: GAAGGCAAGAACGGTGAAGGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: CCR
Primer_f	: CTGCTGGTCCTGGAATACTCG
Primer_r	: CCTTTCCCATTGATGTCACTG
PCR product length	: 169 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	95 bp
Genome contig ID	gi51511734f_73456589
PolyA signal sequence (None)	+--------+--------+----*----+---- GCCCCACAGACCCGCTGGAACCCAGCAGCGGCCGC
Flanking genome sequence (156029 - 156078)	----+--------+--------+--------+--------+----* CCTTTTGAGTACCTCTGTCCAGGACTGAAGACGAACCTTGGCCGCAGTCC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	f	73556589	73612616	18	99.4	Perfect prediction

Primer_f	: CTGCTGGAAAAGAAGGTGGAC
Primer_r	: GAAGGCAAGAACGGTGAAGGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1582

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information