HUGE

Gene/Protein Characteristic Table for KIAA1105

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB029028
Description :	retinoblastoma-associated protein 140.
HUGO Gene Name :
Clone Name :	hh02687 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5377 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
YES YES

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 2905 bp

Genome contig ID gi89161205r_56529201
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
TGCATTTTTTTACTCAATAAACTTGTCTTAATTTT
Flanking genome sequence
(213840 - 213791)
----+----*----+----*----+----*----+----*----+----*
TGCTTTTGTCGCCCAGACTGGAGTGCAATGGCCCGATCTCAGCTCACTGC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 r 56603472 56643040 8 98.0 Terminal No-hit

Features of the protein sequence	Description

Length: 730 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW65321	100.0	chromosome 3 op...	Homo sapiens
Q9UK61	100.0	Uncharacterized...	Homo sapiens
EAW65323	100.0	chromosome 3 op...	Homo sapiens
XP_001096938	97.9	similar to reti...	Macaca mulatta
EAW65319	95.2	chromosome 3 op...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB095927	2.4e-26	28.8	KIAA2006

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TATGGTGAGTAAGGTTATGCG

Primer_r
: TTGACGTGTTGGCAGTGTTTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	YES	YES
Warning for coding interruption:	YES	NO

Length of 3'UTR	2905 bp
Genome contig ID	gi89161205r_56529201
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TGCATTTTTTTACTCAATAAACTTGTCTTAATTTT
Flanking genome sequence (213840 - 213791)	----+--------+--------+--------+--------+----* TGCTTTTGTCGCCCAGACTGGAGTGCAATGGCCCGATCTCAGCTCACTGC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	r	56603472	56643040	8	98.0	Terminal No-hit

Primer_f	: TATGGTGAGTAAGGTTATGCG
Primer_r	: TTGACGTGTTGGCAGTGTTTG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1105

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information