HUGE

Gene/Protein Characteristic Table for KIAA1116

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB029039
Description :	Putative RNA-binding protein 16.
HUGO Gene Name :	RNA binding motif protein 16 (RBM16)
Clone Name :	hk02574 [Vector Info]
Flexi ORF Clone :	pF1KA1116
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4263 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
NO NO

Warning for coding interruption:
YES YES

Integrity of 3' end

Length of 3'UTR 663 bp

Genome contig ID gi89161210f_154996542
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TGTTTTTAGATGCCAATAAAACTTATTTGTTTGAT
Flanking genome sequence
(200344 - 200393)
----+----*----+----*----+----*----+----*----+----*
AACAGTGTTCTAGGAATTGTATTTTTTTAACCTATAAATTCTTAAAACCT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 f 155096542 155196884 20 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 1330 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_527544	99.5	RNA-binding mot...	Pan troglodytes
BAH12140	98.4	unnamed protein...	Homo sapiens
BAH13862	98.3	unnamed protein...	Homo sapiens
Q9UPN6	100.0	Putative RNA-bi...	Homo sapiens
BAG10422	99.9	RNA binding mot...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB032998	1.1e-23	37.0	KIAA1172

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR006903 115 183 PF04818 Protein of unknown function DUF618

IPR000504 538 605 PF00076 RNA recognition motif

HMMSmart IPR006569 65 195 SM00582 Regulation of nuclear pre-mRNA protein

IPR000504 537 606 SM00360 RNA recognition motif

ProfileScan IPR000504 536 610 PS50102 RNA recognition motif

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006903	115	183	PF04818	Protein of unknown function DUF618
IPR000504	538	605	PF00076	RNA recognition motif
HMMSmart	IPR006569	65	195	SM00582	Regulation of nuclear pre-mRNA protein
IPR000504	537	606	SM00360	RNA recognition motif
ProfileScan	IPR000504	536	610	PS50102	RNA recognition motif

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ATGCTCAGCCACCACCTATAC

Primer_r
: ACTGAGTGATGATTATGTCCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ATGTTGCAGATTCCAGTGGCG
Primer_r	: AAGGAGGTGGAGGGATTGGAC
PCR product length	: 115 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	NO	NO
Warning for coding interruption:	YES	YES

Length of 3'UTR	663 bp
Genome contig ID	gi89161210f_154996542
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TGTTTTTAGATGCCAATAAAACTTATTTGTTTGAT
Flanking genome sequence (200344 - 200393)	----+--------+--------+--------+--------+----* AACAGTGTTCTAGGAATTGTATTTTTTTAACCTATAAATTCTTAAAACCT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	f	155096542	155196884	20	99.5	Perfect prediction

Primer_f	: ATGCTCAGCCACCACCTATAC
Primer_r	: ACTGAGTGATGATTATGTCCC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1116

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information