HUGE |
Gene/Protein Characteristic Table for KIAA1172 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | |
---|---|
Accession No. : | AB032998 |
Description : | Splicing factor, arginine/serine-rich 15. |
HUGO Gene Name : | splicing factor, arginine/serine-rich 15 (SFRS15) |
Clone Name : | hj03919 [Vector Info] |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4719 bp
![]() |
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
cloned DNA seq. | Warning for N-terminal truncation: YES | YES | Warning for coding interruption: YES | YES | |
Length of 3'UTR 363 bp Genome contig ID gi51511750r_31865220 PolyA signal sequence
(AATAAA,-21) +----*----+----*----+----*----+----
ATAGGGATGTTTTTAATAAACTCTATTTTCGTAACFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAACTTTAATGTGTGCTATTCTTCCTACACTGCATTAAGGTGGAAAAGGA
Chr f/r start end exon identity class ContigView(URL based/DAS) 21 r 31965220 31995357 14 99.9 Terminal No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 929 aa
This protein sequence is predicted from the revised DNA sequence
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TGACACACTTAACCCAGATTG | |
: TAGGTGCAGGAACAGGAATAG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 21 |
: GeneBridge 4 | |
: AGTGGGCATCGAGACAGAGAG | |
: GGCTAATGGGAGGTTCAACGG | |
: 136 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |