HUGE

Gene/Protein Characteristic Table for KIAA1124

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00181
Accession No. :	AB032950
Description :	Serine/threonine-protein kinase MRCK beta.
HUGO Gene Name :	CDC42 binding protein kinase beta (DMPK-like) (CDC42BPB)
Clone Name :	fg05708 [Vector Info]
Flexi ORF Clone :	pF1KA1124
Source :	Human fetal brain
Note :	We replaced hj05161, former representative clones for KIAA1124 with fg05708. (2001/5/29)

Features of the cloned DNA sequence	Description

Length: 6678 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1319 bp

Genome contig ID gi51511730r_102368482
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
TGAACAATTTACCTGTCAATAAAGCAGAAGACGGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGTTTTAAAGTTCCCAGTGGTCCGTTTGGATGTGGTAACATGTCACCCGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 14 r 102468482 102593486 37 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 1760 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI55542	100.0	CDC42 binding p...	Homo sapiens
Q9Y5S2	99.9	Serine/threonin...	Homo sapiens
AAD37506	99.8	CDC42-binding p...	Homo sapiens
XP_510180	98.0	CDC42-binding p...	Pan troglodytes
EDL18639	91.9	Cdc42 binding p...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007920	2.4e-58	52.1	KIAA0451
AB014519	6e-32	29.8	KIAA0619
AB011133	5.3e-11	31.2	KIAA0561
AB002301	7e-11	30.3	KIAA0303
AB018350	7.4e-11	35.8	KIAA0807

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000719 125 391 PD000001 Protein kinase

FPrintScan IPR002219 1072 1086 PR00008 Protein kinase C

IPR002219 1088 1097 PR00008 Protein kinase C

IPR002219 1101 1112 PR00008 Protein kinase C

IPR002219 1113 1125 PR00008 Protein kinase C

HMMPfam IPR000719 125 391 PF00069 Protein kinase

IPR000961 409 456 PF00433 Protein kinase

IPR014930 927 988 PF08826 DMPK coiled coil

IPR002219 1075 1127 PF00130 Protein kinase C

IPR001849 1145 1263 PF00169 Pleckstrin-like

IPR001180 1290 1562 PF00780 Citron-like

IPR000095 1631 1645 PF00786 PAK-box/P21-Rho-binding

HMMSmart IPR001245 125 391 SM00219 Tyrosine protein kinase

IPR002290 125 391 SM00220 Serine/threonine protein kinase

IPR000961 392 454 SM00133 Protein kinase

IPR002219 1075 1124 SM00109 Protein kinase C

IPR001849 1145 1265 SM00233 Pleckstrin-like

IPR001180 1293 1568 SM00036 Citron-like

IPR000095 1632 1667 SM00285 PAK-box/P21-Rho-binding

ProfileScan IPR000719 125 391 PS50011 Protein kinase

IPR002219 1074 1124 PS50081 Protein kinase C

IPR001849 1144 1263 PS50003 Pleckstrin-like

IPR000095 1632 1645 PS50108 PAK-box/P21-Rho-binding

ScanRegExp IPR000719 131 154 PS00107 Protein kinase

IPR008271 245 257 PS00108 Serine/threonine protein kinase

IPR002219 1075 1124 PS00479 Protein kinase C

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	125	391	PD000001	Protein kinase
FPrintScan	IPR002219	1072	1086	PR00008	Protein kinase C
IPR002219	1088	1097	PR00008	Protein kinase C
IPR002219	1101	1112	PR00008	Protein kinase C
IPR002219	1113	1125	PR00008	Protein kinase C
HMMPfam	IPR000719	125	391	PF00069	Protein kinase
IPR000961	409	456	PF00433	Protein kinase
IPR014930	927	988	PF08826	DMPK coiled coil
IPR002219	1075	1127	PF00130	Protein kinase C
IPR001849	1145	1263	PF00169	Pleckstrin-like
IPR001180	1290	1562	PF00780	Citron-like
IPR000095	1631	1645	PF00786	PAK-box/P21-Rho-binding
HMMSmart	IPR001245	125	391	SM00219	Tyrosine protein kinase
IPR002290	125	391	SM00220	Serine/threonine protein kinase
IPR000961	392	454	SM00133	Protein kinase
IPR002219	1075	1124	SM00109	Protein kinase C
IPR001849	1145	1265	SM00233	Pleckstrin-like
IPR001180	1293	1568	SM00036	Citron-like
IPR000095	1632	1667	SM00285	PAK-box/P21-Rho-binding
ProfileScan	IPR000719	125	391	PS50011	Protein kinase
IPR002219	1074	1124	PS50081	Protein kinase C
IPR001849	1144	1263	PS50003	Pleckstrin-like
IPR000095	1632	1645	PS50108	PAK-box/P21-Rho-binding
ScanRegExp	IPR000719	131	154	PS00107	Protein kinase
IPR008271	245	257	PS00108	Serine/threonine protein kinase
IPR002219	1075	1124	PS00479	Protein kinase C

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCGTGATTAGTAGCCCGTATG

Primer_r
: CAACATCTGGTACAAAGGGTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CCGTGATTAGTAGCCCGTATG
Primer_r	: CAACATCTGGTACAAAGGGTG
PCR product length	: 123 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1319 bp
Genome contig ID	gi51511730r_102368482
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TGAACAATTTACCTGTCAATAAAGCAGAAGACGGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTTTTAAAGTTCCCAGTGGTCCGTTTGGATGTGGTAACATGTCACCCGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	14	r	102468482	102593486	37	99.7	Perfect prediction

Gene/Protein Characteristic Table for KIAA1124

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information