HUGE

Gene/Protein Characteristic Table for KIAA0561

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05934
Accession No. :	AB011133
Description :	Microtubule-associated serine/threonine-protein kinase 3.
HUGO Gene Name :	microtubule associated serine/threonine kinase 3 (MAST3)
Clone Name :	hh01676 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5887 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1959 bp

Genome contig ID gi42406306f_17993494
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
CCTGGAGCTGGCAGTGAATAAAAGCCCGTATTTAC
Flanking genome sequence
(130002 - 130051)
----+----*----+----*----+----*----+----*----+----*
AAAGATGAGCTCCAACGTCTGGATTTGTGAGGGGCTGAGAAAGGAGGAAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 f 18069605 18123494 26 99.6 Internal No-hit

Features of the protein sequence	Description

Length: 1308 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O60307	100.0	Microtubule-ass...	Homo sapiens
XP_001115216	96.5	microtubule ass...	Macaca mulatta
XP_512507	96.6	microtubule ass...	Pan troglodytes
EAW84657	99.9	hCG36884, isofo...	Homo sapiens
XP_533875	93.4	similar to micr...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023190	5.7e-77	59.6	KIAA0973
AB002301	1e-50	58.8	KIAA0303
AB018350	7.9e-47	59.0	KIAA0807
AB032950	8e-10	31.2	KIAA1124
AB023182	2.8e-06	37.3	KIAA0965

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000719 366 639 PD000001 Protein kinase

HMMPfam IPR015022 55 331 PF08926 Domain of unknown function DUF1908

IPR000719 366 639 PF00069 Protein kinase

IPR000961 657 702 PF00433 Protein kinase

IPR001478 984 1034 PF00595 PDZ/DHR/GLGF

HMMSmart IPR001245 366 625 SM00219 Tyrosine protein kinase

IPR002290 366 639 SM00220 Serine/threonine protein kinase

IPR001478 957 1037 SM00228 PDZ/DHR/GLGF

ProfileScan IPR000719 366 639 PS50011 Protein kinase

IPR001478 949 1037 PS50106 PDZ/DHR/GLGF

ScanRegExp IPR008271 485 497 PS00108 Serine/threonine protein kinase

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	366	639	PD000001	Protein kinase
HMMPfam	IPR015022	55	331	PF08926	Domain of unknown function DUF1908
IPR000719	366	639	PF00069	Protein kinase
IPR000961	657	702	PF00433	Protein kinase
IPR001478	984	1034	PF00595	PDZ/DHR/GLGF
HMMSmart	IPR001245	366	625	SM00219	Tyrosine protein kinase
IPR002290	366	639	SM00220	Serine/threonine protein kinase
IPR001478	957	1037	SM00228	PDZ/DHR/GLGF
ProfileScan	IPR000719	366	639	PS50011	Protein kinase
IPR001478	949	1037	PS50106	PDZ/DHR/GLGF
ScanRegExp	IPR008271	485	497	PS00108	Serine/threonine protein kinase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: CTTTTATTCACTGCCAGCTCC

Primer_r
: TGCTTCCCTTTCTGAGTCCCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CTTTTATTCACTGCCAGCTCC
Primer_r	: TGCTTCCCTTTCTGAGTCCCC
PCR product length	: 110 bp
PCR conditions	: 95 °C15 sec68 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1959 bp
Genome contig ID	gi42406306f_17993494
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- CCTGGAGCTGGCAGTGAATAAAAGCCCGTATTTAC
Flanking genome sequence (130002 - 130051)	----+--------+--------+--------+--------+----* AAAGATGAGCTCCAACGTCTGGATTTGTGAGGGGCTGAGAAAGGAGGAAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	f	18069605	18123494	26	99.6	Internal No-hit

Gene/Protein Characteristic Table for KIAA0561

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information