HUGE

Gene/Protein Characteristic Table for KIAA0973

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00159
Accession No. :	AB023190
Description :	Microtubule-associated serine/threonine-protein kinase 1.
HUGO Gene Name :	microtubule associated serine/threonine kinase 1 (MAST1)
Clone Name :	hj06871 [Vector Info]
Flexi ORF Clone :	pF1KA0973
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4833 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 81 bp

Genome contig ID gi42406306f_12710348
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
GTACACATATAAATAAAGTGCGTCCGTGCTGCGTG
Flanking genome sequence
(136419 - 136468)
----+----*----+----*----+----*----+----*----+----*
AGTTTTCTGGGGCTCACTCCTCTCCAGGCAAGGCGAGACATCACACGACC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 f 12810348 12846765 26 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 1583 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9Y2H9	100.0	Microtubule-ass...	Homo sapiens
XP_001109914	98.4	similar to micr...	Macaca mulatta
Q9R1L5	94.3	Microtubule-ass...	Mus musculus
Q810W7	93.9	Microtubule-ass...	Rattus norvegicus
AAD50548	92.2	syntrophin-asso...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018350	3.3e-97	58.5	KIAA0807
AB011133	4.2e-84	59.4	KIAA0561
AB002301	3.6e-52	54.6	KIAA0303
AB032950	2e-10	35.4	KIAA1124
AB023182	3.4e-07	36.8	KIAA0965

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000719 390 660 PD000001 Protein kinase

HMMPfam IPR015022 72 351 PF08926 Domain of unknown function DUF1908

IPR000719 387 660 PF00069 Protein kinase

IPR000961 678 723 PF00433 Protein kinase

IPR001478 1015 1065 PF00595 PDZ/DHR/GLGF

HMMSmart IPR001245 387 660 SM00219 Tyrosine protein kinase

IPR002290 387 660 SM00220 Serine/threonine protein kinase

IPR001478 988 1068 SM00228 PDZ/DHR/GLGF

ProfileScan IPR000719 387 660 PS50011 Protein kinase

IPR001478 980 1068 PS50106 PDZ/DHR/GLGF

ScanRegExp IPR008271 506 518 PS00108 Serine/threonine protein kinase

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	390	660	PD000001	Protein kinase
HMMPfam	IPR015022	72	351	PF08926	Domain of unknown function DUF1908
IPR000719	387	660	PF00069	Protein kinase
IPR000961	678	723	PF00433	Protein kinase
IPR001478	1015	1065	PF00595	PDZ/DHR/GLGF
HMMSmart	IPR001245	387	660	SM00219	Tyrosine protein kinase
IPR002290	387	660	SM00220	Serine/threonine protein kinase
IPR001478	988	1068	SM00228	PDZ/DHR/GLGF
ProfileScan	IPR000719	387	660	PS50011	Protein kinase
IPR001478	980	1068	PS50106	PDZ/DHR/GLGF
ScanRegExp	IPR008271	506	518	PS00108	Serine/threonine protein kinase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AACGCCCTTCGAAAATACCTC

Primer_r
: CTAGTATGCAGCAGGTTCGAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AACGCCCTTCGAAAATACCTC
Primer_r	: CTAGTATGCAGCAGGTTCGAC
PCR product length	: 171 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	81 bp
Genome contig ID	gi42406306f_12710348
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- GTACACATATAAATAAAGTGCGTCCGTGCTGCGTG
Flanking genome sequence (136419 - 136468)	----+--------+--------+--------+--------+----* AGTTTTCTGGGGCTCACTCCTCTCCAGGCAAGGCGAGACATCACACGACC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	f	12810348	12846765	26	99.7	Perfect prediction

Gene/Protein Characteristic Table for KIAA0973

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information