HUGE

Gene/Protein Characteristic Table for KIAA0965

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00701
Accession No. :	AB023182
Description :	Serine/threonine-protein kinase 38-like.
HUGO Gene Name :	serine/threonine kinase 38 like (STK38L)
Clone Name :	hj06174s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA0965
Source :	Human adult brain
Note :	We replaced hj06174, former representative clones for KIAA0965 with hj06174s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 5181 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3502 bp

Genome contig ID gi89161190f_27188345
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
ATTGAAGGTAAGATAAGAATAAAAACTATGTTTAC
Flanking genome sequence
(181812 - 181861)
----+----*----+----*----+----*----+----*----+----*
AAAATTTCTGTTGATGAAGTTTTTTGGTTTTATTTTTGAGTTTTGAGATA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 f 27288345 27370155 14 99.3 Terminal No-hit

Features of the protein sequence	Description

Length: 489 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001099774	5.4e-188	99.6	similar to seri...	Macaca mulatta
XP_534857	3e-183	97.9	similar to seri...	Canis lupus fam...
Q9Y2H1	7.2e-179	100.0	Serine/threonin...	Homo sapiens
AAQ02530	7.3e-179	100.0	serine/threonin...	synthetic construct
AAI51310	2e-177	99.1	STK38L protein ...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB032950	2.5e-25	39.1	KIAA1124
AB014519	7.5e-24	40.5	KIAA0619
AB023190	4.7e-18	36.8	KIAA0973
AB011133	7.5e-18	37.3	KIAA0561
AB018350	1.1e-17	38.7	KIAA0807

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000719 115 260 PD000001 Protein kinase

IPR000719 299 408 PD000001 Protein kinase

HMMPfam IPR000719 115 408 PF00069 Protein kinase

IPR000961 426 472 PF00433 Protein kinase

HMMSmart IPR001245 115 402 SM00219 Tyrosine protein kinase

IPR002290 115 408 SM00220 Serine/threonine protein kinase

IPR000961 409 470 SM00133 Protein kinase

ProfileScan IPR000719 115 408 PS50011 Protein kinase

ScanRegExp IPR000719 121 144 PS00107 Protein kinase

IPR008271 234 246 PS00108 Serine/threonine protein kinase

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	115	260	PD000001	Protein kinase
IPR000719	299	408	PD000001	Protein kinase
HMMPfam	IPR000719	115	408	PF00069	Protein kinase
IPR000961	426	472	PF00433	Protein kinase
HMMSmart	IPR001245	115	402	SM00219	Tyrosine protein kinase
IPR002290	115	408	SM00220	Serine/threonine protein kinase
IPR000961	409	470	SM00133	Protein kinase
ProfileScan	IPR000719	115	408	PS50011	Protein kinase
ScanRegExp	IPR000719	121	144	PS00107	Protein kinase
IPR008271	234	246	PS00108	Serine/threonine protein kinase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGACACTTGGGACTACTAGAG

Primer_r
: AACACCAAACTCAGTAGCCTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AGACACTTGGGACTACTAGAG
Primer_r	: AACACCAAACTCAGTAGCCTC
PCR product length	: 172 bp
PCR conditions	: 95 °C15 sec60 °C60 sec35 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3502 bp
Genome contig ID	gi89161190f_27188345
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- ATTGAAGGTAAGATAAGAATAAAAACTATGTTTAC
Flanking genome sequence (181812 - 181861)	----+--------+--------+--------+--------+----* AAAATTTCTGTTGATGAAGTTTTTTGGTTTTATTTTTGAGTTTTGAGATA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	f	27288345	27370155	14	99.3	Terminal No-hit

Gene/Protein Characteristic Table for KIAA0965

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information