HUGE

Gene/Protein Characteristic Table for KIAA0807

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB018350
Description :	Microtubule-associated serine/threonine-protein kinase 2.
HUGO Gene Name :	microtubule associated serine/threonine kinase 2 (MAST2)
Clone Name :	hk04449 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4050 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
YES YES

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 58 bp

Genome contig ID gi89161185f_46161167
PolyA signal sequence
(AATATA,-23)
+----*----+----*----+----*----+----
TCAGACCTGTGTAATATATGCTCCTGGAAACCATC
Flanking genome sequence
(113218 - 113267)
----+----*----+----*----+----*----+----*----+----*
TTTATGTCTTTTGCTTGCTTGTTTTCCTTCGGTCAACCCACATGTAACTA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 46260324 46274383 18 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 1329 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAX06949	99.8	microtubule ass...	Homo sapiens
Q6P0Q8	99.8	Microtubule-ass...	Homo sapiens
EAX06948	99.8	microtubule ass...	Homo sapiens
AAH65499	99.8	Microtubule ass...	Homo sapiens
XP_001105249	96.2	microtubule ass...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023190	6.9e-89	58.6	KIAA0973
AB011133	9.2e-47	59.1	KIAA0561
AB002301	3.1e-45	52.6	KIAA0303
AB032950	1.2e-09	36.4	KIAA1124
AB023182	3.1e-06	38.0	KIAA0965

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000719 43 316 PD000001 Protein kinase

HMMPfam IPR000719 43 316 PF00069 Protein kinase

IPR000961 334 379 PF00433 Protein kinase

IPR001478 670 720 PF00595 PDZ/DHR/GLGF

HMMSmart IPR001245 43 316 SM00219 Tyrosine protein kinase

IPR002290 43 316 SM00220 Serine/threonine protein kinase

IPR001478 643 723 SM00228 PDZ/DHR/GLGF

ProfileScan IPR000719 43 316 PS50011 Protein kinase

IPR001478 635 723 PS50106 PDZ/DHR/GLGF

ScanRegExp IPR008271 162 174 PS00108 Serine/threonine protein kinase

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	43	316	PD000001	Protein kinase
HMMPfam	IPR000719	43	316	PF00069	Protein kinase
IPR000961	334	379	PF00433	Protein kinase
IPR001478	670	720	PF00595	PDZ/DHR/GLGF
HMMSmart	IPR001245	43	316	SM00219	Tyrosine protein kinase
IPR002290	43	316	SM00220	Serine/threonine protein kinase
IPR001478	643	723	SM00228	PDZ/DHR/GLGF
ProfileScan	IPR000719	43	316	PS50011	Protein kinase
IPR001478	635	723	PS50106	PDZ/DHR/GLGF
ScanRegExp	IPR008271	162	174	PS00108	Serine/threonine protein kinase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GGCTATGGGAGTCTGAGTGTG

Primer_r
: CTTTTGATGGCCCCCTGGTTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GGCTATGGGAGTCTGAGTGTG
Primer_r	: CTTTTGATGGCCCCCTGGTTC
PCR product length	: 176 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	YES	YES
Warning for coding interruption:	YES	NO

Length of 3'UTR	58 bp
Genome contig ID	gi89161185f_46161167
PolyA signal sequence (AATATA,-23)	+--------+--------+----*----+---- TCAGACCTGTGTAATATATGCTCCTGGAAACCATC
Flanking genome sequence (113218 - 113267)	----+--------+--------+--------+--------+----* TTTATGTCTTTTGCTTGCTTGTTTTCCTTCGGTCAACCCACATGTAACTA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	46260324	46274383	18	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA0807

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information